Busch Lab

ZMP

grk7a

Ensembl ID:
ENSDARG00000020602
ZFIN ID:
ZDB-GENE-050824-1
Description:
G-protein-coupled receptor kinase 7a [Source:RefSeq peptide;Acc:NP_001027011]
Human Orthologue:
GRK7
Human Description:
G protein-coupled receptor kinase 7 [Source:HGNC Symbol;Acc:17031]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12074 Splice Site, Nonsense Available for shipment Available now
sa18724 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa44525 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12074
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
Genomic Location (Zv9):
Chromosome 2 (position 16358336)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16869163
GRCz11 2 16537753
KASP Assay ID:
2259-1792.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATCTTGGTCTCGCTGTGGAGATTGCTGTTGGGAAGACCATCAGCCAG[A/T]AGKTGAGTTCTTCGKCTCTATGCTGTGATTTGTTCCACTGAWGCCACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18724
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
ENSDART00000100287 Splice Site, Nonsense 345 549 2 4
Genomic Location (Zv9):
Chromosome 2 (position 16358336)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16869163
GRCz11 2 16537753
KASP Assay ID:
2259-1792.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATCTTGGTCTCGCTGTGGAGATTGCTGTTGGGAAGACCATCAGCCAG[A/T]AGGTGAGTTCTTCGTCTCTATGCTGTGATTTGTTCCACTGATGCCACAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25785
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100287 Nonsense 355 549 3 4
Genomic Location (Zv9):
Chromosome 2 (position 16361306)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16872133
GRCz11 2 16540723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTTTGTTTCCCTTAACACAGGCTGGAACAGGTGCGTATATGGCACCT[G/T]AAATCCTCAATGAGACTCCATACAGAACATCAGTGGACTGGTGGGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44525
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100287 Nonsense 448 549 4 4
Genomic Location (Zv9):
Chromosome 2 (position 16363063)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16873890
GRCz11 2 16542480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAAAATTGTACAATTTCCACAGGAATGATGATCCTAGGAAGCACGAGT[G/A]GTTCAAGTCCATCAACTTTGCTCGCTTGGAGGCTGGACTAATCGATCCAC
Associated Phenotype:
Not determined