Busch Lab

ZMP

gnl3l

Ensembl ID:
ENSDARG00000020595
ZFIN ID:
ZDB-GENE-040723-1
Description:
guanine nucleotide-binding protein-like 3-like protein [Source:RefSeq peptide;Acc:NP_001002875]
Human Orthologue:
GNL3L
Human Description:
guanine nucleotide binding protein-like 3 (nucleolar)-like [Source:HGNC Symbol;Acc:25553]
Mouse Orthologue:
Gnl3l
Mouse Description:
guanine nucleotide binding protein-like 3 (nucleolar)-like Gene [Source:MGI Symbol;Acc:MGI:2448557]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa21915 Nonsense Available for shipment Available now
sa44740 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026249 Nonsense 148 565 6 15
Genomic Location (Zv9):
Chromosome 11 (position 26424040)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25252865
GRCz11 11 25490481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTTCTGGATGCCAGAGACCCTTTAGGCTGCCGCTGTCCACAGGTTGAA[C/T]AGGCTGTTGTCCAAAGTGGAACCAACAAAAAAATTGTACTTGTTCTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026249 Essential Splice Site 167 565 6 15
Genomic Location (Zv9):
Chromosome 11 (position 26424099)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25252924
GRCz11 11 25490540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCAAAGTGGAACCAACAAAAAAATTGTACTTGTTCTAAATAAAATTGG[T/C]AAGAGAGACCTTAATATATTACTGTGCTCAGTTTATGAAGTTTAAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11450
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026249 Nonsense 462 565 13 15
Genomic Location (Zv9):
Chromosome 11 (position 26434388)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25263213
GRCz11 11 25500829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACCTCTGGATTGACACAAGGAGGTCAAGGGGAAGATCTGGCAGAATTG[C/T]AGATGGATGAACCRTTAGRTGACCCTGAACTTCAAGACAARGTTGAATTA
Associated Phenotype:
Not determined