Busch Lab

ZMP

LOC100331283

Ensembl ID:
ENSDARG00000020581
Human Orthologue:
OTOF
Human Description:
otoferlin [Source:HGNC Symbol;Acc:8515]
Mouse Orthologue:
Otof
Mouse Description:
otoferlin Gene [Source:MGI Symbol;Acc:MGI:1891247]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa28936 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14223 Nonsense Available for shipment Available now
sa43010 Nonsense Mutation detected in F1 DNA Not yet available
sa17767 Essential Splice Site Available for shipment Available now
sa13068 Nonsense Available for shipment Available now
sa16297 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28936
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Essential Splice Site 429 1801 10 41
Genomic Location (Zv9):
Chromosome 17 (position 50892202)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50283019
GRCz11 17 50362088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGAGCTCCACTGAGGTGCAGGTGGAGGGGATACCCAACATCTCTGATG[T/C]AAGCAATCTACTAATTACAGTCAATAATTCATCGTCTTTATTTATCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14223
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 540 1801 13 41
Genomic Location (Zv9):
Chromosome 17 (position 50886668)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50277485
GRCz11 17 50356554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGGAATTATTTCCMCCTGCCGTACTTTGAGAGGAAGCCCTGCATCTA[C/A]ATCTACAGCTGGTGGCAGGACCAACGACGACGACTTTATAATGCTAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43010
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 761 1801 18 41
Genomic Location (Zv9):
Chromosome 17 (position 50880977)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50271794
GRCz11 17 50350863
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTGAACAGGCAGCGTAAGGACTATCTATGCGGTCTGCCTAACGGGTTC[G/T]AGGAGAACAAGGCAGTGAAGGGGCCGGGCGTTCAGTCCTCTCCCCCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17767
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Essential Splice Site 825 1801 20 41
Genomic Location (Zv9):
Chromosome 17 (position 50878952)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50269769
GRCz11 17 50348838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTAGGACATGGTGTTARTAWAGCTTTGAATTGTTTWGCTGGTTTCTCTC[A/G]GGTACTGAAYGAGACRCTGTGTCCCACATGGGATCAGCTGCTGGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13068
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 1042 1801 24 41
Genomic Location (Zv9):
Chromosome 17 (position 50873067)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50263884
GRCz11 17 50342953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCCTCCGCTGAACATCCGCGTGGTGGACTGCCRAGCGTTTGGCCGCTA[C/A]ACGCTGGTCGGCTCTCATGCCGTCACAACTCTGCGCAAGTTCATCTACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4729
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Essential Splice Site 1259 1801 30 41
Genomic Location (Zv9):
Chromosome 17 (position 50867570)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50258387
GRCz11 17 50337456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTGGATCAGAATGCAGCTGATGAAGACAGACTCATTGGCAAGTTCAAG[G/A]TCTGTTCACATTTGTTGTCCAAGGAACATATGATCTSACAGGCAGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16297
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041685 Nonsense 1772 1801 41 41
Genomic Location (Zv9):
Chromosome 17 (position 50850490)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50241307
GRCz11 17 50320376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAGGCAATCCGCCATCTCGTCTGCAACCAATACAAGTGGCTGGTCATC[A/T]AAATAGTGGTGGCTCTGCTGCTTTTAGCAATGCTGGGCTTGTTTCTGTAC
Associated Phenotype:
Not determined