Busch Lab

ZMP

atp2a1

Ensembl ID:
ENSDARG00000020574
ZFIN ID:
ZDB-GENE-020905-1
Description:
ATPase, Ca++ transporting, fast twitch 1 [Source:RefSeq peptide;Acc:NP_001007030]
Human Orthologue:
ATP2A1
Human Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 [Source:HGNC Symbol;Acc:811]
Mouse Orthologue:
Atp2a1
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 Gene [Source:MGI Symbol;Acc:MGI:105058]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16659 Essential Splice Site Available for shipment Available now
sa17743 Essential Splice Site Available for shipment Available now
sa10632 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16659
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Essential Splice Site 515 1005 14 24
ENSDART00000129561 Essential Splice Site 515 994 13 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26883443)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26020793
GRCz11 3 26151664
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCTGCAAAGGCCTCCAAGGCTCCTGTTGGAAACAAGATGTTTGTYAAG[G/A]TAAGACCAATCATTTAGTTACCTAGTTAAAATTAATATCTTAACACGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17743
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Essential Splice Site 626 1005 16 24
ENSDART00000129561 Essential Splice Site 626 994 15 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26882913)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26021323
GRCz11 3 26152194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNCCCATTGAGCTGTGCAGGGCTGCTGGCATTCGTGTGATCATGATCACAGG[T/C]AAATCMCTAAACCTGAACCTTAATCTTCAAAAMGCACTGAAACATYATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8121
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Nonsense 680 1005 17 24
ENSDART00000129561 Nonsense 680 994 16 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26882609)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26021627
GRCz11 3 26152498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCCCARCAGAGAGAAGCGGTGCGTAAGGCCTGCTGTTACGCTCGTGTT[G/T]AGCCCTCCCACAAGAGCAAGATCGTTGAGTTCCTTCAGGGCTTTGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10632
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043932 Nonsense 836 1005 19 24
ENSDART00000129561 Nonsense 836 994 18 24
ENSDART00000134647 None None 103 None 9
ENSDART00000146267 None None 98 None 5
ENSDART00000146979 None None 39 None 3

The following transcripts of ENSDARG00000020574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 26881824)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26022412
GRCz11 3 26153283
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCTCCCCGCTCCCCCAAAGAGCCYCTTATCTCCGGCTGGCTCTTCTTC[A/T]GATAYCTGGCCATTGGAGGTATGATACTTTTCATTTTTNCTGATTTATTTC
Associated Phenotype:
Not determined