Busch Lab

ZMP

hacl1

Ensembl ID:
ENSDARG00000020529
ZFIN ID:
ZDB-GENE-040426-2058
Description:
2-hydroxyacyl-CoA lyase 1 [Source:RefSeq peptide;Acc:NP_998250]
Human Orthologue:
HACL1
Human Description:
2-hydroxyacyl-CoA lyase 1 [Source:HGNC Symbol;Acc:17856]
Mouse Orthologue:
Hacl1
Mouse Description:
2-hydroxyacyl-CoA lyase 1 Gene [Source:MGI Symbol;Acc:MGI:1929657]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa5889 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39097 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5889
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004031 Essential Splice Site 293 568 10 17

The following transcripts of ENSDARG00000020529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22266298)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20372741
GRCz11 16 20178560
KASP Assay ID:
554-3910.1 (used for ordering genotyping assays)
KASP Sequence:
ACACTTTGGCTTTCCACCCAGATTCAGTGCCAATGTAAAGATCATTCAGG[T/G]TAGTTAGAACCTTAACRCTGAGGAAGTTGCTGCAGCATCWCTGTAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39097
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004031 Nonsense 399 568 13 17

The following transcripts of ENSDARG00000020529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22271445)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20377888
GRCz11 16 20183707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCATAGTGAGTGAGGGAGCAAACACTATGGACATCGGCCGCACCATGT[T/A]GCTCAATCACCTCCCTCGGCACAGGTGAGAGACACTATTGGCAGCTTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1547
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004031 Nonsense 433 568 14 17

The following transcripts of ENSDARG00000020529 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22274985)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20381428
GRCz11 16 20187247
KASP Assay ID:
554-1490.1 (used for ordering genotyping assays)
KASP Sequence:
TGGGGGTAGGTCCAGGCTTTGCCATCGCAGCAGCAGTTCTGGAGCAAGCG[C/T]AGAGAKTYGGCCAAAAAGTGGTGTGTGTGGAAGGAGACAGTGCTTTCGGC
Associated Phenotype:
Not determined