Busch Lab

ZMP

CASKIN1 (2 of 3)

Ensembl ID:
ENSDARG00000020489
Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13391 Essential Splice Site Available for shipment Available now
sa32586 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13391
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113289 Essential Splice Site 19 1358 2 33
Genomic Location (Zv9):
Chromosome 1 (position 7085059)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7373968
GRCz11 1 8058079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGATKTTAATGTTGTTWAAGTGGTTGAATCATATTTGTGTGTTTTAC[A/G]GGTTATCTGCCCTGCATCATGCTGCTCTTAATGGAAAYGTGGAGCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32586
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113289 Essential Splice Site 1322 1358 31 33
Genomic Location (Zv9):
Chromosome 1 (position 7051229)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7341615
GRCz11 1 8025726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCAGCTGCTCTGGAAGTCGTGGAGGAAAAGATTAAGAAGGATGACAG[G/A]TACATGAGTGGATGTTTCTAGACATTAAAAACAAATTCTGTTTTTCCTCT
Associated Phenotype:
Not determined