Busch Lab

ZMP

zgc:110306

Ensembl ID:
ENSDARG00000020488
ZFIN ID:
ZDB-GENE-050417-56
Description:
hypothetical protein LOC550254 [Source:RefSeq peptide;Acc:NP_001017592]
Human Orthologue:
ARHGAP17
Human Description:
Rho GTPase activating protein 17 [Source:HGNC Symbol;Acc:18239]
Mouse Orthologue:
Arhgap17
Mouse Description:
Rho GTPase activating protein 17 Gene [Source:MGI Symbol;Acc:MGI:1917747]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42018 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35275 Nonsense Mutation detected in F1 DNA Not yet available
sa22085 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4463
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713 Essential Splice Site 92 250 4 9
ENSDART00000115015 Essential Splice Site 62 774 2 17
Genomic Location (Zv9):
Chromosome 12 (position 21807017)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20332650
GRCz11 12 20454524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCCATGCAGGACGGTGGGAACCAGCTGGGGGAGGAGTCTCTGATTGGG[T/C]AAAATGGCATGACATCATCATCGATTTACAATTAAGTCTGCTTCTTTRTT
Long Flanking Sequence:
CAAAGGCTTTCTGATGGCTATGAGTAAAACCTGCTGAATTTATGAAATGCGTTTCATGTCACAGAAAAACACATGCTTTGTTACATAACTTGTCCTAGGCACTTAATTAACAGGCTGTTTACTTCCAATACAATGCATACAGACTTTGCACTGAGTGAGAGTCATGGCTCAATATGGATTGTGGGCCGTTATTGACATTTAGGTTTTTTTTCTGCACAGATTGAACGCCGTATGGAGTTGGTGCGGGTCGTTTCGCACAACACGCACAAAAAAATGGCTGTGTGTTTGCAGGGGCAGATTGGCACTGATGCTGAGAAGAGACATGTAAGGGCATTACCGGTGCTTATGGCTGCACAAAATGTCAGTCATCATTGCATATTTTGGATGTATTGTTGCACAAACTCAGTGTGTTTCTGTCACAGAAAAAGCTTCCACTGACAGCGCTGTCACAGGCCATGCAGGACGGTGGGAACCAGCTGGGGGAGGAGTCTCTGATTGGG[T/C]AAAATGGCATGACATCATCATCGATTTACAATTAAGTCTGCTTCTTTGTTGTTAAATCGGAAATTGATTAGCTCTTTGTATTATTAATATGAGATGATGACTCAAAAAAGTTGCCTAGCTTGATCATTAAATTGTTGTAAAGTGGATAAAACATTTATAATATTACAAGATTAAATGTTATTAATTGTCATGCGATCATGAGATAAGACAAAATGCTTGTAAATTATTAATTAATTTATTAATTAGTTTATTTATTTATTTATTTTTGTTTATTACTGTTCTGAGCAAGGTATTTTAATAAAAGTTGTTTTCATATAGTCCACAAGACAGAAAAAATACCTGAAATTATTTGAGTGATCAAATTTTTTTGTGGAAAACCAGATATATCTGAAGTTGTAACTTAATAGAAGAAACTATCCATACGCAACAAGTCATAATATTAGAGTGATTTCTGAAGGACTTTGTGAGACTGTCATAATGACTGAAGGTTTTGCTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42018
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713 None None 250 None 9
ENSDART00000115015 Essential Splice Site 322 774 10 17
Genomic Location (Zv9):
Chromosome 12 (position 21820863)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20346496
GRCz11 12 20468370
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTTTGATGACTTACCAGCTGTATGATGAATGGATACAGGCCTCCAAG[T/C]AAGCCATCTAACTGTGGTTTACACTAGGCTTTAAATGAAGTTTGTGTTGT
Long Flanking Sequence:
CAGTCCATTCAGGCAGGTCCAGTCTATTGAATCTTCTAATCTATTCAAGGCAGATCAATGAATGTTTTCAGTTGTTTACATATCTAAAATGTTTGAATTATCAAAAAATATGATATTATTGTTTTGGCAATGATCAATCAAAACAAAACTTTAGAATCTTGATAGGATCATTTTGGGACTTTGCTGGCAATGTAAATATGCCTGTATGCTTATTCTCCAGGGTCTGTTCCGCATCGCAGCAGGAGCCTCTAAACTGAAGAAGCTGAAGGCTGCTCTGGATTGCTCCACCTCACAGCTGGAGGAGTTTTACTCAGATCCACATGCTGTTGCTGGTACGGCCTGTTCTGTTAGTGTATCAGTAATATGTCAGTCAAACTTAATAAATGGTGATTTCTAACTATGCTCTCTTGGTTTAAGGGGCACTGAAGTCGTATCTCAGAGAGTTGCCTGAACCTTTGATGACTTACCAGCTGTATGATGAATGGATACAGGCCTCCAAG[T/C]AAGCCATCTAACTGTGGTTTACACTAGGCTTTAAATGAAGTTTGTGTTGTTCATTTGTGTTGCACTTTTGTTTTGTCAAGTGTTCCTGACCCAGACAAACGATTACAAGCTTTGTGGGTTACCTGCGATCAGTTACCAAAAAACAACAAGGCAAACTTCAGGTGAGCTTCTAATGCATATGAATGCGAAGACAAATAGTGGAGAATAAATATTGTTTTAATTATGAAAAATAAGTTATGAAATGATTGAATGATGAAAATGAACGATTTTCTTAAATTTAAGTGTTTTTATTTTTTATTTTGATTTAGGTATTTATTGTTTACCAATATGTTTGAAACGTATGCACATACACTACCGGTCAAAAGTTTGGGATGAGTCTGGTTTAAAATGTTTTAAAATAAGCTTCACCTGCTCACCAAGGCTGCATTTATTTCATCAAAAATACAGTACAAGTTGTAAAATTGTTAAATGTTATTGCACTATAAAATAACTGTTCAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27944
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713 None None 250 None 9
ENSDART00000115015 Essential Splice Site 470 774 14 17
Genomic Location (Zv9):
Chromosome 12 (position 21824198)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20349831
GRCz11 12 20471705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCTGGCAGTATGGTTGGTCCAGATGGGGATATGCCCCGAAGAGACAG[G/A]TAACATTTTACACCAAAGTGTTTGATTCTCTAAATCAGTTACACTGGTTA
Long Flanking Sequence:
CAGGAAAGTGACGTTAACAAGATGACGCCCAGCAACATCGCCATTGTCCTTGGACCCAACTTACTGTGGGCCAAAACTGAGGGGTAACAATATTTTGCAAATGCAACAAACACATTATCATCCTTCATTGTATCCTTTTAAAAACACAGTCTATCTACTCTCAGGAGCCTAGCAGAAATGGCTGCTGCAACCTCTGTCCATGTGGTTACTATAATCGACCCCATCATCCAGCATGCGGACTGGTTTTTCCCTGAGGGTATGTGCTGTAAAGCTGTAAATGTCTTAGTGAAAGAAAGCATCTCTATCACTTTTAAGATGAACCTGTTTCTTGTTATTCATTTAGATGTGGATTTTAATGTATCCGGCATGTTTTCGATGCCCGCACCCCTGCCAAACAATGTCAATCACCTGACGCCGCCAGATTATGACTCAGGCACCATAGAGAGAAAGAGACCTGGCAGTATGGTTGGTCCAGATGGGGATATGCCCCGAAGAGACAG[G/A]TAACATTTTACACCAAAGTGTTTGATTCTCTAAATCAGTTACACTGGTTATTTACTCATGCTTCACCAAGATCAATCCACTTTAATTGAGCAATTAAAAAAATTGATCAAATTACACTCACATAGTACTGGGCGATTTATTTTGTACGATTATTTCAAATTAATTATTAAATTGTAACTAAACATAGCATCTGTTACCATGTTTTGTTTTGTTAGCAAAAGTGTAATTTAACAAATACTACAAAGCACTAGAGGGCGCTTGTTAAACTCTCTGTCTGTTAAATAAGGAAAGGATGTAAAAGTAGTAGTTTGATAAAAAAAAAAAAACATGCGCTGCGCCCCAATTCACGTACTTATACTGCACCCTAGAAGTATGTACTTTTTGTGGAGGAAAAGTATATATTTTTGAGTATGTAACAGAAGAGTATGCAAGCTTTGGGACATACTACTCGCTCTTTAACATATCGTTATGTTGCTTAGTTAAGTCCCCAGTCAATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35275
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713 None None 250 None 9
ENSDART00000115015 Nonsense 562 774 16 17
Genomic Location (Zv9):
Chromosome 12 (position 21828675)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20354308
GRCz11 12 20476182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTTTGTTGATTGACTTTTCTGTCTGTTTGTTTAACAGTTCAAAGAGC[C/T]GAGACTCTGCATCCACTCCTCCTGCTCAGAGAAATGGCACTGGAGGCTCA
Long Flanking Sequence:
CCTTATTAACCTAGTTCAACTAGTGACTTTAAATGTCACTTTAAGCTGCATATAAGTGTCTTGAAAAATATCTAGTAAAAGTTATATCTAGTTATTTACTGTCATCATGACAAAGATAAAATAAGTCAGTTATTAAAGATGAGTTATTAAAACTTGCATGTTTATAAAAGAGAAGAAAAAATCTTCTGTTCGTTAAACATAAATTGGAGAAAAAATAATCGGGGGCTAATAATTCTGACTTCAACTGTATATAAAGAATAAATTTTACTGGGGTATTACATAATAATAGTTATGTACTTTTCCGGTTATTCCAAGCTGTAAATTATTTTATTCGTAAACTAATTGTGAGAATACAAGTTGCTGTTTTATACAACTTAATGTCAAAATATTCCATCGGAGAAAGTTGGAGTTTGCATGCTGCAGAATAAATATTAATAAATGAATATTATTAATTTTTGTTGATTGACTTTTCTGTCTGTTTGTTTAACAGTTCAAAGAGC[C/T]GAGACTCTGCATCCACTCCTCCTGCTCAGAGAAATGGCACTGGAGGCTCAGGACAGCTGAGTGTGGGGACCCCTGTGGCGGGATCTACAGGACCCAGTCCTCACATGACACGCAGAGGTTAGTGGACTTGCCTTAAAAAAAGGTGAAGGCCCAAAATATACTCACTACTCAATGTACTTGGGCCCAATCCCAATTCTACCTCTTAGCCCTTCCCCTTACCCCTACCCCTCGTTTTGCATGTGAAGTGGTAGGGGTGTGCCAATTCTCTTTATCGTGAATGATAGTGCTAAGGCATAGGACTATATACCCCTTCGAACATAGATTTTTCAGGACCACACTTGAAACCAATGGGTAAAAAATTTTTTGTCATTATTACGAATTTTAATACAATTATAACCTTCATGCTTAAAAAAAAAAAAAAGAAAAAAAAAAAGCTAAAATAAAAATGCCTAAATTTTGCTGTCTACAATCCCTAATAAAAATTCTTGTATAGTAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22085
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713 None None 250 None 9
ENSDART00000115015 Nonsense 628 774 17 17
Genomic Location (Zv9):
Chromosome 12 (position 21830868)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20356501
GRCz11 12 20478375
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCAGCCAACCCTCCACCAATCCAACCAGCCAATCAGCCCGTTCCACAA[C/T]AGACCCAATCAGGCACCCCTCAGTCCTTCAGCCCGTCCCCTAGACCGCTT
Long Flanking Sequence:
GGATTAAAAAAACCCCATATATTTCTAAATTTCTCTGTATACACTAGTATCTTGTGAAAAACTAGCTAAACATTATGTACTGTCATCATGGCAAAGGCAAAAAAATACTTATTAAAACTTATGTTAAAAAAATGTATTGAAAAAATCTTATATCTGTTGAAAACAATTGGGAAATATTAAATCAGAAACTCAGAAATCAAATTTCACAGCAAAGGCTAATAAATCTGACTTTATGTCTAACAAATCAAGGTCATCTAGCACATTTGAGTTTAATTTTGAATTAAATAAAATTAAACTCTGAAGGGAAAATATGCAGAAATGTGCAAGAATTAATAGAAGTGTAAGGCCTTTATATTATGAGATCAACTCAAAACGGCAGAAAGAGCTTATATTAAATTGCCTTTTACTGTATATTTCTAGGTACAAAGAAGCCTGCTCCAGCTCCACCTAAACCAGCCAACCCTCCACCAATCCAACCAGCCAATCAGCCCGTTCCACAA[C/T]AGACCCAATCAGGCACCCCTCAGTCCTTCAGCCCGTCCCCTAGACCGCTTTCCAGTTACTCTCCAACCAATCTGAGCCCCACACAGACCCAGGCCCAAACCAACACCACCCCACGCCGCCACTCCAGCAACCAGCCTCCCATTCAGGCACCCAACCACCCACCTCCACAGCCCCCGACCCAAACCACTCCACCTCCCCAAACCGGCATGCTTGGTGACCAAGCTGAAGACCCCTCGCCTCCACATACCCCCACCCCACCGAGCACCCCTCCTCCCACAGCAGTCTTCCAGGACAGTCCTAGTCCCACCGCGCCTCCGGTGTTCCAGTCAGGGTCGCTTCCACGCCCCAGGCCTGTGCCCAAACCACGCAACAGACCCACTGTCCCCCCTCCGCCTCAGCCTCCAGCCATAGGAAGTGACAGCAATGGAATTTGCAGCGCTGCCTTCAAAACAATGGGTGAAGCTCTTTTATTTCCCTCACACTGTAGGCTGCTGAGTAAC
Associated Phenotype:
Not determined