Busch Lab

ZMP

map3k7

Ensembl ID:
ENSDARG00000020469
ZFIN ID:
ZDB-GENE-041001-135
Description:
mitogen-activated protein kinase kinase kinase 7 [Source:RefSeq peptide;Acc:NP_001018586]
Human Orthologue:
MAP3K7
Human Description:
mitogen-activated protein kinase kinase kinase 7 [Source:HGNC Symbol;Acc:6859]
Mouse Orthologue:
Map3k7
Mouse Description:
mitogen-activated protein kinase kinase kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1346877]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa230 Nonsense Confirmed mutation in F2 line Not yet available
sa23699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa230
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 22 562 1 19
ENSDART00000025862 Nonsense 22 551 1 16
ENSDART00000124919 None None 211 None 6
ENSDART00000130414 Nonsense 27 602 1 18
Genomic Location (Zv9):
Chromosome 20 (position 24164723)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24283524
GRCz11 20 24182624
KASP Assay ID:
554-0128.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGATATGCTGGAAACACCGCCTATGTATCCGTTTGAGGAGATCGATTA[T/A]GTTGATATTGAAGTGGAAGAGGTGAGTGATTTCATATGCGTTCTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23699
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 355 562 13 19
ENSDART00000025862 Nonsense 371 551 11 16
ENSDART00000124919 None None 211 None 6
ENSDART00000130414 Nonsense 377 602 11 18
Genomic Location (Zv9):
Chromosome 20 (position 24149218)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24268019
GRCz11 20 24167119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGTCTTCCTGGCAGGTCACATTTTCAGCCTTCCTCTGACAGCAAA[C/T]GAATGAGTGTCGAACTCTCCGAATTGGAGCCCAGATTACCCTTTGCTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4899
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Essential Splice Site 503 562 18 19
ENSDART00000025862 Essential Splice Site 492 551 15 16
ENSDART00000124919 Essential Splice Site 152 211 5 6
ENSDART00000130414 Essential Splice Site 543 602 17 18
Genomic Location (Zv9):
Chromosome 20 (position 24138017)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24256818
GRCz11 20 24155918
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAATACCTGAAGGTGCAGACAGAGATCGCACTTCTCAAACAGAGAAAG[T/C]AAGTCAGAGGAATATGAATCCRTTCAAATAATCAGCATGTATAATACGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29359
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018545 Nonsense 517 562 19 19
ENSDART00000025862 Nonsense 506 551 16 16
ENSDART00000124919 Nonsense 166 211 6 6
ENSDART00000130414 Nonsense 557 602 18 18
Genomic Location (Zv9):
Chromosome 20 (position 24134985)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24253786
GRCz11 20 24152886
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTCTACAGGGAAGAGCTGATAGCAGAACTAGACCAAGATGAAAAGGAT[C/T]AACAGAACGCATGTCGCCTCGCTCAGGAGCAAAAGAAGCTCATAGAGGAG
Associated Phenotype:
Not determined