Busch Lab

ZMP

EXT1A_DANRE

Ensembl ID:
ENSDARG00000020373
Description:
Exostosin-1a [Source:UniProtKB/Swiss-Prot;Acc:Q5IGR8]
Human Orthologue:
EXT1
Human Description:
exostosin 1 [Source:HGNC Symbol;Acc:3512]
Mouse Orthologue:
Ext1
Mouse Description:
exostoses (multiple) 1 Gene [Source:MGI Symbol;Acc:MGI:894663]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22952 Nonsense Available for shipment Available now
sa36257 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2874 Nonsense F2 line generated Not yet available
sa36258 Nonsense Mutation detected in F1 DNA Not yet available
sa9715 Splice Site, Nonsense Available for shipment Available now
sa4684 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa22952
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Nonsense 324 730 2 11
Genomic Location (Zv9):
Chromosome 16 (position 51878640)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48602953
GRCz11 16 48544971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTATAAAGAAATGCTGCACAACTCCACATTCTGTCTGGTGCCGAGAGGA[C/T]GACGCCTGGGCTCTTTCCGCTTCCTGGAGGCTCTGCAGGTACACTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36257
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Essential Splice Site 336 730 2 11
Genomic Location (Zv9):
Chromosome 16 (position 51878679)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48602992
GRCz11 16 48545010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCGAGAGGACGACGCCTGGGCTCTTTCCGCTTCCTGGAGGCTCTGCAG[G/A]TACACTTTTACAGTCCAATTTTGTTGCTAATTACAGGCTGTTACTGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2874
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Nonsense 368 730 3 11
Genomic Location (Zv9):
Chromosome 16 (position 51889184)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48613497
GRCz11 16 48555515
KASP Assay ID:
554-3318.1 (used for ordering genotyping assays)
KASP Sequence:
CCTTCTCCGAGATCATCRACTGGCGGACGGCTGCTGTCATCGGGGACGAG[A/T]GACTTCTTCTACAGGTAACACTTCCAGAAAACATCAAAACCCCAAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36258
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Nonsense 382 730 4 11
Genomic Location (Zv9):
Chromosome 16 (position 51896275)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48620588
GRCz11 16 48562606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGCTCTCTTCTCTTCGCAGATTCCATCGACAGTTCGCTCCATCCAT[C/T]AAGATCGCATTCTGTCACTCCGGCAGCAGACGCAGTTCCTCTGGGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9715
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Splice Site, Nonsense 528 730 7 11
Genomic Location (Zv9):
Chromosome 16 (position 51901087)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48625400
GRCz11 16 48567418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCGCTGGCCTGCTACTTCAGTTCCTGTCATCGTAATCGARGGCGAGAGC[A/T]AGGWRAATCTGCGCCGTCTTTATATTCTCTTATCAAATCAARTGTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4684
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006439 Essential Splice Site 528 730 7 11
Genomic Location (Zv9):
Chromosome 16 (position 51901091)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48625404
GRCz11 16 48567422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGCCTGCTACTTCAGTTCCTGTCATCGTAATCGAGGGCGAGAGCAAGG[T/A]GAATCTGCGCCGTCTTTATATTCTCTTATCAAATCAARTGTCTGGTGCTG
Associated Phenotype:
Not determined