Busch Lab

ZMP

fbp1b

Ensembl ID:
ENSDARG00000020364
ZFIN ID:
ZDB-GENE-021206-11
Description:
fructose-1,6-bisphosphatase 1b [Source:RefSeq peptide;Acc:NP_998297]
Human Orthologue:
FBP2
Human Description:
fructose-1,6-bisphosphatase 2 [Source:HGNC Symbol;Acc:3607]
Mouse Orthologue:
Fbp2
Mouse Description:
fructose bisphosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:95491]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa7570 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051313 Missense 121 337 3 7

The following transcripts of ENSDARG00000020364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 37078570)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34860519
GRCz11 5 35460672
KASP Assay ID:
554-4156.1 (used for ordering genotyping assays)
KASP Sequence:
GTACTTTTTNTTTGTTACCCAGGGCAAATACGTGGTTTGTTTTGACCCTC[T/A]GGATGGCTCTTCAAACATTGACTGCTTAGCGTCTATTGGAACTATTTTTG
Associated Phenotype:
Not determined