Busch Lab

ZMP

slc2a8

Ensembl ID:
ENSDARG00000020344
ZFIN ID:
ZDB-GENE-030829-25
Description:
solute carrier family 2, facilitated glucose transporter member 8 [Source:RefSeq peptide;Acc:NP_997
Human Orthologue:
SLC2A8
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 8 [Source:HGNC Symbol;Acc:13812]
Mouse Orthologue:
Slc2a8
Mouse Description:
solute carrier family 2, (facilitated glucose transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa7576 Missense Mutation detected in F1 DNA Not yet available
sa9411 Essential Splice Site Available for shipment Available now
sa18829 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20575 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26619
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Nonsense 16 498 1 10
Genomic Location (Zv9):
Chromosome 5 (position 68957024)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150155.1 432
GRCz11 KN150155.1 432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGCAATGAATGAGTATGAAGAAAACAGACCACTGTTGGTCAATGATGAG[C/T]GAACAGAAGAGGATAGATCCGAGCAAGACGCATACCTGGAGTAAGGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7576
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Missense 180 498 4 10
Genomic Location (Zv9):
Chromosome 5 (position 68963287)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65297345
GRCz11 5 65976460
KASP Assay ID:
554-4348.1 (used for ordering genotyping assays)
KASP Sequence:
YAGAGGAACTTTGGGATCCTGTGTGCAACTAATGGTTGTGATAGGCATTA[T/G]GGGTGCTTATGTAACAGGTATTGCCTCTCATTTTAAACTTGTGACTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Essential Splice Site 256 498 5 10
ENSDART00000019648 Essential Splice Site 256 498 5 10
Genomic Location (Zv9):
Chromosome 5 (position 68966014)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65300067
GRCz11 5 65979182
KASP Assay ID:
2259-6810.1 (used for ordering genotyping assays)
KASP Sequence:
CCCCGCCGAGTGGGAATGCGCTAGAATAGAAGATGCCTACAAAAATGAAG[T/C]TAGACATCACCAAGTTTTTWGGKTCTTYATTTTATTRAACATAAWGARCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Essential Splice Site 256 498 5 10
ENSDART00000019648 Essential Splice Site 256 498 5 10
Genomic Location (Zv9):
Chromosome 5 (position 68966014)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65300067
GRCz11 5 65979182
KASP Assay ID:
2259-6810.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCGCCGAGTGGGAATGCGCTAGAATAGAAGATGCCTACAAAAATGAAG[T/C]TAGACATCACCAAGTTTTTTGGGTCTTCATTTTATTGAACATAATGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20575
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Nonsense 319 498 7 10
Genomic Location (Zv9):
Chromosome 5 (position 68968515)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65302553
GRCz11 5 65981668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTGCCGCAGAGCAGTGATGTGGCCACTGTTATTGTCGCAGCCACA[C/T]AGGTGGTCTTCACTGCAATTGCTGCTCTTATAATGGACAAGGCCGGGCGG
Associated Phenotype:
Not determined