Busch Lab

ZMP

si:ch211-153f2.5

Ensembl ID:
ENSDARG00000020323
ZFIN ID:
ZDB-GENE-030131-4581
Description:
Novel protein similar to vertebrate nucleoporin 153kDa (NUP153) [Source:UniProtKB/TrEMBL;Acc:B8JIZ6]
Human Orthologue:
NUP153
Human Description:
nucleoporin 153kDa [Source:HGNC Symbol;Acc:8062]
Mouse Orthologue:
Nup153
Mouse Description:
nucleoporin 153 Gene [Source:MGI Symbol;Acc:MGI:2385621]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa1945 Nonsense Available for shipment Available now
sa6570 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13705 Essential Splice Site Available for shipment Available now
sa15361 Essential Splice Site Available for shipment Available now
sa13251 Essential Splice Site Available for shipment Available now
sa13432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1945
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Nonsense 285 1436 6 22
ENSDART00000142054 None None 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47882139)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46453143
GRCz11 19 46043763
KASP Assay ID:
554-1933.1 (used for ordering genotyping assays)
KASP Sequence:
TGGCTGACCCGGGGTGTTGGTCTGTCACTWTACAGCCTCCTGTTAGGAGA[C/T]AGATCAAGGCAAAGCCAACCGGAGCTCAGCCCTGTGGAGTGACCAGTGCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29270
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Nonsense 390 1436 9 22
ENSDART00000142054 None None 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47887146)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46448136
GRCz11 19 46038756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCTCAATATCCTTTAGACCATCACTCACCCCAGGTGGAGTGAGCAGA[G/T]GAGTGGAAAAAACCAGCAGAGAGACTGTGAGTGCGCTTTCTAGCACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Essential Splice Site 416 1436 None 22
ENSDART00000142054 Essential Splice Site 8 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47888091)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46447191
GRCz11 19 46037811
KASP Assay ID:
554-4856.1 (used for ordering genotyping assays)
KASP Sequence:
TAAGACAATCCCCTCCGATTTCAGAACCCGCCCAGGCTCCCCCTCCAAGG[T/C]AAGAGTAAACGGTTTGTTTTTATTATTATTAGAATTATTTACTCTTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13705
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Essential Splice Site 600 1436 None 22
ENSDART00000142054 Essential Splice Site 191 239 None 7
ENSDART00000146781 None None 281 None 5
ENSDART00000039415 Essential Splice Site 600 1436 None 22
ENSDART00000142054 Essential Splice Site 191 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47890052)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46445230
GRCz11 19 46035850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAAGGTCTTAAAACAGGGCAGTGTGTTGGACATACTTAAGGGTCCTGG[T/C]ATGATTTGTTTTTCCTCATTTATTTATTTCTCTCTATGAAACTTTAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15361
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Essential Splice Site 600 1436 None 22
ENSDART00000142054 Essential Splice Site 191 239 None 7
ENSDART00000146781 None None 281 None 5
ENSDART00000039415 Essential Splice Site 600 1436 None 22
ENSDART00000142054 Essential Splice Site 191 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47890052)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46445230
GRCz11 19 46035850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAAGGTCTTAAAACAGGGCAGTGTGTTGGACATACTTAAGGGTCCTGG[T/C]ATGATTTGTTTTTCCTCATTTATTTATTTCTCTCTATGAAACTTTAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13251
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Essential Splice Site 856 1436 17 22
ENSDART00000142054 None None 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47892754)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46442528
GRCz11 19 46033148
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGGCCTGCCAGTCAGCAAAACCAGGAGCTAAAATAGAGTCCAAAGG[T/G]AAAGTGCCTTGCAGTCAYATTTCAGCAGCTGCATRYTGTTTTGAAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039415 Nonsense 911 1436 18 22
ENSDART00000142054 None None 239 None 7
ENSDART00000146781 None None 281 None 5

The following transcripts of ENSDARG00000020323 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 47893001)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46442281
GRCz11 19 46032901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGYACTTTCTCAGATTCATCCAYCACAGGAGGAATTAAATTTGGGTTT[G/T]GATTGTCGTCCWCGAGTTCAGAGGGCTTCAAATTTGGAGGCTCGTCMTCA
Associated Phenotype:
Not determined