Busch Lab

ZMP

si:ch211-254n4.3

Ensembl ID:
ENSDARG00000020292
ZFIN ID:
ZDB-GENE-081105-89
Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 [Source:RefSeq peptide;A
Human Orthologues:
FAM19A2, FAM19A4, FAM19A5
Human Descriptions:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 [Source:HGNC Symbol;Acc:2
family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 [Source:HGNC Symbol;Acc:2
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 [Source:HGNC Symbol;Acc:2
Mouse Orthologues:
Fam19a2, Fam19a4, Fam19a5
Mouse Descriptions:
family with sequence similarity 19, member A2 Gene [Source:MGI Symbol;Acc:MGI:2143691]
family with sequence similarity 19, member A4 Gene [Source:MGI Symbol;Acc:MGI:2444563]
family with sequence similarity 19, member A5 Gene [Source:MGI Symbol;Acc:MGI:2146182]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7139 Nonsense Mutation detected in F1 DNA Not yet available
sa8387 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7139
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030609 Nonsense 27 132 1 4
ENSDART00000146132 Nonsense 27 132 2 5

The following transcripts of ENSDARG00000020292 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 28283234)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27411152
GRCz11 8 27430291
KASP Assay ID:
554-4837.1 (used for ordering genotyping assays)
KASP Sequence:
TGCGTGGATCGTACTGGTATTTTTGGCCCTTGTGTTGTTTTGGGGTCATT[T/A]GTCTGAAGCGTCTTCTCACCGCAGTCACATCGGTAAGTCAAGTTCATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8387
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030609 Nonsense 54 132 2 4
ENSDART00000146132 Nonsense 54 132 3 5

The following transcripts of ENSDARG00000020292 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 28229769)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27357687
GRCz11 8 27376826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCACGTGAAAGCTGGCACATGTGAGGTGATTGCAGCCCATCGCTGCWG[T/A]AACAGAAATAAGATTGAGGAGCGATCGCAGACGGTCAAGTGTTCCTGCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27221
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030609 Nonsense 108 132 3 4
ENSDART00000146132 Nonsense 108 132 4 5

The following transcripts of ENSDARG00000020292 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 28224786)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 27352704
GRCz11 8 27371843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCAGAAGTGGTGGTGTCAAATGCAGCCATGTGTGGATGGTGAGGAGTG[T/A]AAAGTCCTGCCCGACCTCACAGGCTGGAGCTGCAGCACGGGCAACAAGGT
Associated Phenotype:
Not determined