Busch Lab

ZMP

efcab7

Ensembl ID:
ENSDARG00000020279
ZFIN ID:
ZDB-GENE-040625-115
Description:
EF-hand calcium-binding domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001002120]
Human Orthologue:
EFCAB7
Human Description:
EF-hand calcium binding domain 7 [Source:HGNC Symbol;Acc:29379]
Mouse Orthologue:
Efcab7
Mouse Description:
EF-hand calcium binding domain 7 Gene [Source:MGI Symbol;Acc:MGI:2385199]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20725 Nonsense Available for shipment Available now
sa20724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20725
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016629 Nonsense 528 603 11 13
ENSDART00000139055 Nonsense 531 606 11 13

The following transcripts of ENSDARG00000020279 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 31724532)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32045448
GRCz11 6 32032362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGCTAAAGCTCTGAAGGGCCATGAGAATGTGCTTGTTTACACATA[C/A]AAAGGAGAGAGCAGGATTTCATCAGTCATTGCTAATAAGGTGGGTTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20724
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016629 Nonsense 589 603 13 13
ENSDART00000139055 Nonsense 592 606 13 13

The following transcripts of ENSDARG00000020279 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 31721839)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32042755
GRCz11 6 32029669
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGGTCTCTGTTTAGGTTTGTCAGCACGTCATGGCTTTAAACGATCAA[C/T]AGGAGTGGACTTACAACTGCACTGAGAGCATTATACCAAGTTTGTAAATG
Associated Phenotype:
Not determined