Busch Lab

ZMP

ewsr1a

Ensembl ID:
ENSDARG00000020258
ZFIN ID:
ZDB-GENE-030131-2317
Description:
Ewing sarcoma breakpoint region 1a [Source:RefSeq peptide;Acc:NP_001108610]
Human Orthologue:
EWSR1
Human Description:
Ewing sarcoma breakpoint region 1 [Source:HGNC Symbol;Acc:3508]
Mouse Orthologue:
Ewsr1
Mouse Description:
Ewing sarcoma breakpoint region 1 Gene [Source:MGI Symbol;Acc:MGI:99960]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44719 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15021 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27558
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024282 Essential Splice Site 150 626 6 16
ENSDART00000141445 Essential Splice Site 121 325 6 10

The following transcripts of ENSDARG00000020258 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7013190)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8025990
GRCz11 10 7984690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCATCAGTGTGCATTTGATTTTTCACTAATGCTTTCTTTTCTCTTTCA[G/A]CAGTTACAGTTCTGGGAGCCAGCAGCCTGCCGGATATGAGCAGAGCTCGT
Long Flanking Sequence:
GTTTCCTTGTCAGACATAGTATTTTATATCTTAATTTTTACTTTACAAACCAACTAGAACCTTACCCTATCACCCACATGAAAAAAGACACTAGTAATTTTTAGTAAATAATTTGGTTTGATTCCTGCTATTGTAGTTTATAATACTGTGTATGTATAATACATGCATACATACAGTATTATAAACTACAATAGTGTGTATGTGTACATGTACATATTTATATTAATAGTGTAAATTGTAATAAATGCTGTCATATACTTCAGTTTTTACTACAGTAAACTATGCAGTATAATATGCCCTATATTTGAAGAAAACTACAGTATTTGTACTGTATAATATAGTACTGTATCATTTGTTTATTACCATAGTTGTTACTATAGCAGATAAAGAATTACCACAACAGCATAATTCATGAAACAAGTATAATACAAATATCAGTTAATGTATACTACTCATCAGTGTGCATTTGATTTTTCACTAATGCTTTCTTTTCTCTTTCA[G/A]CAGTTACAGTTCTGGGAGCCAGCAGCCTGCCGGATATGAGCAGAGCTCGTACTCCCAGCAGCCTCAGCAAAGCACTTATTCTCAGCAGCAGCAGGGAGGATACCAGGGCCAGCAAGGAGGCTACGGACAGCAGAGCTCCTATAGCCAGCAGGGAGGATATCAACAAACTCCTCCCCAGCAGCAGCAGGCTCCGCCTTCCAGCTATGCTCCGCCTTCTGGATCTTATGGACAGCCTTCTGCCAGTCAGTATGGACAGCAGGGCAGTACTGGAGGAGGTTATGGCCAATCAGACTATAAACCACCAAACCAGTATGGTAAGTCTGCTGGAGGTGGCTAATCGGAGACTTGTGTTCAAATGCAAAAATGTCAGTGACACTTGATTCTTTTACAGGTAGTTACAGACCAGACCATCAGAATGGAGGTGGCTATTCTGGCCCTGAATCTGGAGGATATGGGGGCCCTGGAGAGGGCCGAGGCATGGGAGGGGGGGAGAACCGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44719
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024282 Essential Splice Site 504 626 None 16
ENSDART00000141445 None None 325 None 10

The following transcripts of ENSDARG00000020258 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7005166)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8017966
GRCz11 10 7976666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATTAATTGCCCAGAGCCTGTTCAATGAGGATTTACTTCTTTTTTTTT[A/G]GTGGATGTGGAAACCAAAACTTTGCCTGGAGAATGGAGTGTAATCAGTGC
Long Flanking Sequence:
GATGGTGCGTTGATCTGAACCAAAATCAGTCCTCAAAGGAATGAAATGAGCCCTCAACATGAATGTTTGTTCTTTAGGAAAAGATTTCCAAGGGAAGAAGCTGAAGGTGTCAATGGCCAGACGCAAGCCCATGATGGGTATGATGCGCGGGGGTATGCCAATGAGAGGAGACCGCGGTGGCATGATGGGACGAGGAGGTACTCTGCTGCATTCATGTTTCAGATGCAGCCATTTAATTTCACAGCAGTTTCAATATAAATCGTCTCTCTCTCCAGGAATGATGGGTCGTGGTGGAATGGGCAGAGGTGGTGATCGCGGAGGGTTTATGCCACGTGGGGGTCCCAGGGGAATGGGTCGTGGAGGACCTACTGGAGGAAACATGCAGCAGAGGGCAGGAGACTGGCAGTGTCCAAATGCGTATGTATTTCACTAGTGATGCTTGATCAGAGTACAATTAATTGCCCAGAGCCTGTTCAATGAGGATTTACTTCTTTTTTTTT[A/G]GTGGATGTGGAAACCAAAACTTTGCCTGGAGAATGGAGTGTAATCAGTGCAAGGCACCCAAACCTGAAGGCTTCGGACCTCCTCCCTTCCCTCCAGGTTACTTTTTATATTCATGTAAAGCTCTTATAGGCGCTTAAAGTGTTTGCATTGCTAATATTTAATGAATCCTATGTGATTCAGGTGGTGATCGCGGTCGTGGTGGTCCTGGTGGGATGCGTGGTGGTCGTGGTATGGATCGCGGAGGACCAGGGGGACCCGGAGGCTTCCGTGGAGGCAGAGGTGTGGACCGTGGAGGCTTCAGAGGACGTGGTATGGACAGAGGGGGCTTTGGAGGAAGGGGTCGTGGAGGCCCTCCAATGGATGACATGGGCCGAAGGGGGCGAGGAATGGGACCACCGGGCAAAATGGATATGAAGTGAGTATTAAGCTCGTCTCTGTGATGGTGTTAAAGCCATAAAACGGAACATATTAAATTGAATCTTTTAATTATTTTGCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15021
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024282 Nonsense 600 626 15 16
ENSDART00000141445 None None 325 None 10

The following transcripts of ENSDARG00000020258 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7004794)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8017594
GRCz11 10 7976294
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GRGGCTTTGGAGGAAGGGGTCGTGGAGGSCCTCCAATGGATGACATGGGC[C/T]GAAGGGGSCGAGGAATGGGACCACCGGGSAAAATGGATATGAAGTGAGTA
Long Flanking Sequence:
AGGAAACATGCAGCAGAGGGCAGGAGACTGGCAGTGTCCAAATGCGTATGTATTTCACTAGTGATGCTTGATCAGAGTACAATTAATTGCCCAGAGCCTGTTCAATGAGGATTTACTTCTTTTTTTTTAGTGGATGTGGAAACCAAAACTTTGCCTGGAGAATGGAGTGTAATCAGTGCAAGGCACCCAAACCTGAAGGCTTCGGACCTCCTCCCTTCCCTCCAGGTTACTTTTTATATTCATGTAAAGCTCTTATAGGCGCTTAAAGTGTTTGCATTGCTAATATTTAATGAATCCTATGTGATTCAGGTGGTGATCGCGGTCGTGGTGGTCCTGGTGGGATGCGTGGTGGTCGTGGTATGGATCGCGGAGGACCAGGGGGACCCGGAGGCTTCCGTGGAGGCAGAGGTGTGGACCGTGGAGGCTTCAGAGGACGTGGTATGGACAGAGGGGGCTTTGGAGGAAGGGGTCGTGGAGGCCCTCCAATGGATGACATGGGC[C/T]GAAGGGGGCGAGGAATGGGACCACCGGGCAAAATGGATATGAAGTGAGTATTAAGCTCGTCTCTGTGATGGTGTTAAAGCCATAAAACGGAACATATTAAATTGAATCTTTTAATTATTTTGCAGGGGAGACCACCGCCAGGACCGTAGAGAGCGGCCGTATTAATTGATGCCCAGCGTGTTCTTCCTGCCCCAATGTTAATTTCTCACATGGTTTTAAAGTTGCATTTCCATATTTATGAGTAGTTAGTATGGAACTCGTTAATGCTTTGCCGTTAGTCTTCAGTGAAGGTTATATTTTATTTTTTTAAGTTTTTGTGTTTTGTCCTCGCTTTCCTGGTCAAGAAGTGTCCATGAAACCAGGTGCACATGTAAATGCAGGGTGTTTGGTGTGCCATTTGGATTTGTCAGAAATGTATTTGTGGAAATGTGAGGGTATTTTTAAGTTCCCAATAACCCTCATGTTTTGCTCTACTCTGCGTTCATGTGTGGAAATGTGGA
Associated Phenotype:
Not determined