Busch Lab

ZMP

fermt2

Ensembl ID:
ENSDARG00000020242
ZFIN ID:
ZDB-GENE-050506-132
Description:
Fermt2 protein [Source:UniProtKB/TrEMBL;Acc:Q58EF4]
Human Orthologue:
FERMT2
Human Description:
fermitin family member 2 [Source:HGNC Symbol;Acc:15767]
Mouse Orthologue:
Fermt2
Mouse Description:
fermitin family homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2385001]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36538 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28937
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049464 Nonsense 483 684 12 16
ENSDART00000085996 Nonsense 483 684 11 15

The following transcripts of ENSDARG00000020242 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 51308243)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50699060
GRCz11 17 50778129
KASP Assay ID:
2261-1622.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGCCTGCCGTCTGGCCTCTAAAGGGAAGACCATGGCGGACAGTTCCTA[C/A]AATCTGGAGGTCCAGAACATTCTGTCCTTCCTGAAGATGCAGCACATGAA
Long Flanking Sequence:
TTATTTATTTATTTATTTGTTTATTCAGTTACATTATTATTTTCATGTGTTTATCATTTGTATTTACTTATTTATTTATTTTAAAAAATGATGATGATACTACTACTACTAGTAATAATAATAATTGTTATTGTTATTATTATTATTATTAGTAGTAGTAGTAGTATTACAATACAATAATTATATATCCTATTTCTCAGGGTGCAGTTTTGTAATTTCCAAGTTGCCAAAGTGGCCTTTCATTTCCTAAAAATAAATGCATTACGCTGACAAAAGCAAACAACACAATTACTAGAATGATTTACATTAAAATGCAAAAGGATCACTCCAGAAATGAAAGTAATTGAGAATCTGCTGGAGTTATAGCAGTGACTGTAAATCCCAGCAGTGTGACTCAGAGGATGTTCTGCTATGTCTGTGTTGCAGGAGAAGCAGTACGCTCAGTGGATGGCCGCCTGCCGTCTGGCCTCTAAAGGGAAGACCATGGCGGACAGTTCCTA[C/A]AATCTGGAGGTCCAGAACATTCTGTCCTTCCTGAAGATGCAGCACATGAATCCTGATCCGCAGATCATCGAGCCCATCACCACCGACATCAACCCTGAGTGTCTGGTGTCTCCACGATACCTGAAGAAATACAAGAACAAGCAGGTAAATGCAGGATAGAACTCAATCAATATATAAAACAAAACCTGAACAGCAGGTCAAAGCACTGAAAATAACTGATCTGGTCTGTTTTTATTTATTAAATGATGGATGAAAGTTTGATATTAATCTAATGTTGCATTCATTTTAATTAATCACATTAATTAATTTTAAATATGTCACATAACCCTAATTGTCCAAAAGATAGCTCCCGCTGCAGTGCTGTGAATATACAGGGCTCGAGTCAAAAACAAGAGGAAAGTTGGGGAGCATGTGTGTGTTTTTGCATGTCTGTTTGTGTGTTTGTGTATATTTGTGTTGTGTGTGTGTGTCTGGTGACTGTGTGTCTGTGCATCTTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049464 Nonsense 663 684 16 16
ENSDART00000085996 Nonsense 663 684 15 15

The following transcripts of ENSDARG00000020242 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 51317576)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50708393
GRCz11 17 50787462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTAAAGTGGTGCACGAGTTCATCGGCGGCTACATCTTCCTGTCCACT[C/T]GAGCCAAGGACCAGAACGAGTCTCTGGACGAGGAGATGTTCTACAAGCTG
Long Flanking Sequence:
GATGACAGTAAATAATATTTGACTAGATATTTTTCAAGACACTAGCATTCAGCTCAAAGTACCATTTAAAGGCTGATTTAATTAGGCTAATAATATTGAACTTAAAATGGTGTTTAAAAAATTAAAAACTGCTTAATTCTAGCCGAAATAAAACAAAAAAGACTTTCTCCAGAAGAAAAAATATTATCAAACATACTGTGAAAATTTCCTCATCCTCATTTCCACATCATCAATCAAAAATATTCACATGAGGGCTAATAATTCAGACTTCTACTGAACATGGTCAAAAAATAACAACATATATGGTAGATCCCAATCTAGAACAAGAGTTGTCGATCATTCATGGAGATCAGAATCTCGTGCTCATTTCTGATCCAGACGTACTCTGTTTTCAGGTGACGGTGGAGTTTGCGGACGAGCCCAGTCTGGCGTTCATCTGTGCGGAGGTGGACTGTAAAGTGGTGCACGAGTTCATCGGCGGCTACATCTTCCTGTCCACT[C/T]GAGCCAAGGACCAGAACGAGTCTCTGGACGAGGAGATGTTCTACAAGCTGACCAGCGGCTGGGTTTAATCCACTTTGCTTTTTCCTTTAACCATCGCTCCGTCATAATGGTTTGAAAACTGAAGCTTTTTCTTGTTTTTTTAAATTCTGTTCATGCGCATGAACGCATCGATAACACTAGCAGAACAGCGAGTCCACTGCTCTGAGTCAAAGAGCGTTTTTTTTTTTTTCCTGCTTCCCTCCAGAAATGATTGGGTTGTAGAGATGAAGCAATAGTAGCTGATGGTCACACACACACATATATATATATGACCTTTCACCCTCGGTAGAAATATGCCAGCTTTCTGCACCGCCAGTTATTTATTTGTGACTAATTTCCGTTGCGTCTCTTTTGGGTAATTGTTGAATGTCGCGGTGCTCGTTTGTGCCTATTAATCTTCTATGTTAAATATATCACGCTCATGTGATGACACTAGCGAAGGAGCTGTTACACTCGCTTTA
Associated Phenotype:
Not determined