Busch Lab

ZMP

si:dkey-103i16.1

Ensembl ID:
ENSDARG00000020236
ZFIN IDs:
ZDB-GENE-060503-47, ZDB-GENE-060503-47
Description:
liprin-beta-1 [Source:RefSeq peptide;Acc:NP_001038435]
Human Orthologue:
PPFIBP1
Human Description:
PTPRF interacting protein, binding protein 1 (liprin beta 1) [Source:HGNC Symbol;Acc:9249]
Mouse Orthologue:
Ppfibp1
Mouse Description:
PTPRF interacting protein, binding protein 1 (liprin beta 1) Gene [Source:MGI Symbol;Acc:MGI:1914783

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9195 Nonsense Mutation detected in F1 DNA Not yet available
sa29003 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9195
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007064 Nonsense 211 951 7 26
ENSDART00000099823 Nonsense 211 1013 7 27
Genomic Location (Zv9):
Chromosome 18 (position 15193988)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15546400
GRCz11 18 15514912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTCGTTTTTTTTTTAGGGTTTGATTTTGGAGATCAATGAACTGAGATA[T/G]CGCATTTCTGAGATGGAGAATGAGCGGTTACAGTATGAAAAGAAACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29003
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007064 Essential Splice Site 399 951 12 26
ENSDART00000099823 Essential Splice Site 461 1013 13 27
Genomic Location (Zv9):
Chromosome 18 (position 15178200)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15530612
GRCz11 18 15499124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCAGACAAAGCAGACAGCGACTCAGTCCTGGAACACATGCAGTCAAGG[T/A]AGAGTTTCAGATCAGCACAATTAAACACATTTTCTTCATGCAGGATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23262
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007064 Nonsense 917 951 25 26
ENSDART00000099823 Nonsense 979 1013 26 27
Genomic Location (Zv9):
Chromosome 18 (position 15149198)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15501610
GRCz11 18 15470122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGCACCTTTTTATGGCCCAGATGGAAGACTCTGAAGGGACAGTGAGA[C/T]AGATTGGAGCTTTCTCTGAGGGCATCAACAACTTAACGGTAACAAACAAC
Associated Phenotype:
Not determined