Busch Lab

ZMP

spag6

Ensembl ID:
ENSDARG00000020158
ZFIN ID:
ZDB-GENE-040704-53
Description:
sperm-associated antigen 6 [Source:RefSeq peptide;Acc:NP_001002210]
Human Orthologue:
SPAG6
Human Description:
sperm associated antigen 6 [Source:HGNC Symbol;Acc:11215]
Mouse Orthologues:
BC061194, Spag6
Mouse Descriptions:
cDNA sequence BC061194 Gene [Source:MGI Symbol;Acc:MGI:3040687]
sperm associated antigen 6 Gene [Source:MGI Symbol;Acc:MGI:1354388]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6762 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa13900 Splice Site, Nonsense Available for shipment Available now
sa44115 Nonsense Mutation detected in F1 DNA Not yet available
sa31100 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30074
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Essential Splice Site 8 507 1 11
Genomic Location (Zv9):
Chromosome 24 (position 17819116)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17125592
GRCz11 24 17270011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGATTTTGGATTTTAATAAAATTATGAGTCAACGACAGATTTTGCAAG[G/A]TGAGAAAGTTAGATTGAACAATACAATGATAACATAGATGTAATAATACA
Long Flanking Sequence:
AAATAAATATGCGAACTTGAGGAGTAATTACTAAATGTCACTGTTGTTCTGATTGCAGTTGTCTGTGCGGTAACCTAAAGAAACTCATGTGGGGGCAGCTGTTCGCCCTCGCAGCTGCTCTGCCCCGATATCCCACATTCATCGACCGTTCGTGAATCTCGTTTAATATCCCAATCTAATTAGGGATTATTTAACGCGCTATTACATCTGGACATTAACTGTAAACGGCAACGATGCCCGACTTTGAAAGAACATGACTGTTTCACACGAAACATTCGGAAGAACATTGACAGCAAGCTCATTGAAAAAGAAGTGCATTTCACTTCCGGTTTGTTACCAAGACAACAGTTGCACGCCTCCTGTAAACTCAGTCACAACAAACGCTATTTCCTAATGGACGTTTAAACGCGTATTTCTGTGGCATAATCGCAGCTTTTTTATCGTTTTTACTCTGATTTTGGATTTTAATAAAATTATGAGTCAACGACAGATTTTGCAAG[G/A]TGAGAAAGTTAGATTGAACAATACAATGATAACATAGATGTAATAATACAATCGTTTAATTACAAGTTAATTACATGTACTAGAGTTTGTTTACTTTTTTGCAGTTTATTGACATTAATGTCTAATGACATACCTGGCTATTGCTGTCAGTATGAAGCACCAAATTATTGTTATTATTTTGCAGTGTTTGAGCAGTACCAGAAAGCAAGAACCCAGTTTGTACAAACTGTTGCAGATCTTGCTACAAGACCACAAAATAGTGAAACCCTTCAAAATGCTGGTGAGTATCTGTGTAAAAAAAATGTTATGAGAAAGGCAAATGAAAGGGCATCTGAAAACGCTTTTTATGCTACAGAACAGGTAATAAAATTTTATAGTGAAAAATTTTATAATTTTTATAATATATATAATATTTATTATTAACTCTAGTTGCTGATCATATGTGAGCTCAATAATACTTAAGTTGAGTAGGCGGTACTGTTCATTGTAATTACAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Splice Site, Nonsense 97 507 4 11
Genomic Location (Zv9):
Chromosome 24 (position 17822532)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17129008
GRCz11 24 17273427
KASP Assay ID:
554-5357.1 (used for ordering genotyping assays)
KASP Sequence:
TATGATTGCTTTGTCCATTCCCCTATGAATAYATGGGATATGAAAGACAG[C/T]GATTCTATAAGAARGCTGCTGCATTCGTTCTTCGGGCTRTTGCTAAGCAT
Long Flanking Sequence:
AATTTGGATCCTTATTTTGTATTTTCTATTGGATTCCAGTCAGGTGATTGGCTGGGCCATTCTACAACTTGATTTTCTTTTTTTGAAAGCATTTGTGAGTTACTTTGGCTGTGTTTTGGATAATTGTCTTGCTGTAATATCCACCCTGGCTTCATCATCTTGTTAATGTAGAGGTCAGCTTGAAGCAGCTGTAATAATTTACAATGATAAAGGTTAGATGGTTGCTGAATAACTACTAAGAGATTTCAGCTGCTGTCTGGGCATTCACTAATTTGGTGAATTGAATTGAATTAATTTCTACATCTTCTTTTCTTCATGTGTTCAATACTTTTTCCCAGTGTCCTAAGTTTTTCTCAGAGGATGAAAAAAATAAAACCTTGATAAATTCTATAAATATCTAAAGCTGCATTTCAGGACTGCTTGTCATTCCTTTCTTAAGTGTAATTAATATATGATTGCTTTGTCCATTCCCCTATGAATATATGGGATATGAAAGACAG[C/T]GATTCTATAAGAAAGCTGCTGCATTCGTTCTTCGGGCTGTTGCTAAGCATTCCCCCGAGCTGGCCCAGGCTGTGGTGGACTGTGGAGCAGTGGACGCTCTTGTCATCTCCCTGGAGGAGTTCGATCCTGGGGTCAAAGAGGCTGCTGCATGGGCTATAGGCAACATCGCCAGACATAATGGCCGTAAGTGTAAAGCTAAAAGGGTTTTTTAATGTTTACGGTAATGTTGCCCTAGCTGTTCATCTTTTCTCTCCTGGTGTGCAGAGCTGTCTCAGGCAGTGGTTGATGCTGGAGTTGTGCCTCTGCTCGTGTTATGCATCCAGGAACCTGAAATAGCCCTGAAGAGAGTTGCTGCTTCTGCTCTGAGCGATATAGCCAAACATTCTCCAGAGCTGGCTCAAACTGTGGTGGACACAGGGGCAATCGCACACCTTGCACAGATGATCCTAAACCCAGATGCCAAATTGAAGGTCACAAAGCCTACAGATATTATAATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13900
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Splice Site, Nonsense 226 507 5 11
Genomic Location (Zv9):
Chromosome 24 (position 17823000)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17129476
GRCz11 24 17273895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGCAATCGCACACCTTGCACAGATGATCCTAAACCCAGATGCCAAATTG[A/T]AGGTCACAAAGCCTACAGATATTATAATCAATGACTCGCAAAGGGATAGT
Long Flanking Sequence:
TCCCCTATGAATATATGGGATATGAAAGACAGCGATTCTATAAGAAAGCTGCTGCATTCGTTCTTCGGGCTGTTGCTAAGCATTCCCCCGAGCTGGCCCAGGCTGTGGTGGACTGTGGAGCAGTGGACGCTCTTGTCATCTCCCTGGAGGAGTTCGATCCTGGGGTCAAAGAGGCTGCTGCATGGGCTATAGGCAACATCGCCAGACATAATGGCCGTAAGTGTAAAGCTAAAAGGGTTTTTTAATGTTTACGGTAATGTTGCCCTAGCTGTTCATCTTTTCTCTCCTGGTGTGCAGAGCTGTCTCAGGCAGTGGTTGATGCTGGAGTTGTGCCTCTGCTCGTGTTATGCATCCAGGAACCTGAAATAGCCCTGAAGAGAGTTGCTGCTTCTGCTCTGAGCGATATAGCCAAACATTCTCCAGAGCTGGCTCAAACTGTGGTGGACACAGGGGCAATCGCACACCTTGCACAGATGATCCTAAACCCAGATGCCAAATTG[A/T]AGGTCACAAAGCCTACAGATATTATAATCAATGACTCGCAAAGGGATAGTTCAGCCAAAAATGAAAATCTGTCATTGTTTACTCATCCTTTACTTGATTCAAACCTTAATGAGTTTCTTTCTTATGTTCAACACAAATAGTGAGTTTAATTTCATTTTTGGGTGAACTATATTGTTAATGGTTTTTTTCATACTTGACATAATAAATCTTTGTCATTCTAACCCCCCTGGAAAATGCAATCTTAGGTCAGTCTTTCGCGTTTCACATCACTCAGAGGTTAAGAATTAATCCTGGGCATTTGTAAACTGACATTTCACACTGTACATTTCCAAACCCCGAGTTAACATTCTTAATGCTCTTGGGGTGAATGACATTTTAGAACCGTATTTGGACTTACGTACAAACTTAGTCCTGGAGGGTCACTGTCCTGCAGGGTCTAACTACAGCTTGACTTAACACAACTGAATGTGTGTGCTAGGACATTATATATTAAGGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Nonsense 481 507 10 11
ENSDART00000017605 Nonsense 481 507 10 11
Genomic Location (Zv9):
Chromosome 24 (position 17825573)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17132049
GRCz11 24 17276468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCTGGTTCTGCAATTCAGGAATATATTAATGCAATCAACAACTGTTA[C/A]CCTGAAGAGATTGTCAGGTACATGCACATTTATATGCATAATAAAAAGCA
Long Flanking Sequence:
CCTCTATTTGGACACAGAGAGTTCTGAAGATCTGCAGGTCAAGGTGAACAAAGACATATTTGTGACTGATAGGGGTGTGTATTCATTTGGATGTTTTTTCACTGATTTTTAGACCCTAATGGTGTCTTCTATTGGCTTTGTGTTTGTACTCAAAAAGGCCAAAAAGGGACTGAAGAGCATCCTTCAGAAGTGTACTTATCTACCAGCACTGGAGCCTCTTCTCTATGAAGCTCCCAGCAACATTCTTAAACATGTCATCTGCCAGTTCAGTAAGGTAGCAGGAACATATTGCTTTTATTATCAAACATTTGAACAATGTGTTCTTACTGAGAACTGCTTAAAATACTTTACTGTTTCTTTTCAATCTCAAAGGTTCTTCCTCATGACAGCAAGGCACGGCGTTTGTTTGTTACCAGTGGTGGCTTGAAGAAGGTACAAGAGATCAAAGCAGAACCTGGTTCTGCAATTCAGGAATATATTAATGCAATCAACAACTGTTA[C/A]CCTGAAGAGATTGTCAGGTACATGCACATTTATATGCATAATAAAAAGCACCATATCAAAATATTTTAAACCAAACAATGTGGTTCTGTATTGATTTGATATGTTGTATGATTTTTTTTTCAATTAAATGTTTTCTGCTTTTACAGATATTATTCCCCTGGTTACTCCGAGACCTTGCTGGAAAGGATTGAAAAATATCAGCCAACATGACTTTATGAAACACTAAAACCACTCCATTTTAAACACTTGTGAAAAACAAAGAAGTAAATAAAATGTAATAAAGAAATTAGCAATAGCAATGAATTTAATTTAGTTTGTTTGTCTTGTTTCATGTACAATAGGCCTGTTAAACAAAAGTATATTTTATAGTGGTGTGGATTATTGTGTTTGTAATTAATCAGAGACAACAAAGCTTAGTTTAACCTATTTTTTAAAACTCTGTCTTTGAGAAATCTTGGTCTACAACACGAAAAGGTATTTTATCACATACACTCAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Nonsense 481 507 10 11
ENSDART00000017605 Nonsense 481 507 10 11
Genomic Location (Zv9):
Chromosome 24 (position 17825573)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17132049
GRCz11 24 17276468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCTGGTTCTGCAATTCAGGAATATATTAATGCAATCAACAACTGTTA[C/A]CCTGAAGAGATTGTCAGGTACATGCACATTTATATGCATAATAAAAAGCA
Long Flanking Sequence:
CCTCTATTTGGACACAGAGAGTTCTGAAGATCTGCAGGTCAAGGTGAACAAAGACATATTTGTGACTGATAGGGGTGTGTATTCATTTGGATGTTTTTTCACTGATTTTTAGACCCTAATGGTGTCTTCTATTGGCTTTGTGTTTGTACTCAAAAAGGCCAAAAAGGGACTGAAGAGCATCCTTCAGAAGTGTACTTATCTACCAGCACTGGAGCCTCTTCTCTATGAAGCTCCCAGCAACATTCTTAAACATGTCATCTGCCAGTTCAGTAAGGTAGCAGGAACATATTGCTTTTATTATCAAACATTTGAACAATGTGTTCTTACTGAGAACTGCTTAAAATACTTTACTGTTTCTTTTCAATCTCAAAGGTTCTTCCTCATGACAGCAAGGCACGGCGTTTGTTTGTTACCAGTGGTGGCTTGAAGAAGGTACAAGAGATCAAAGCAGAACCTGGTTCTGCAATTCAGGAATATATTAATGCAATCAACAACTGTTA[C/A]CCTGAAGAGATTGTCAGGTACATGCACATTTATATGCATAATAAAAAGCACCATATCAAAATATTTTAAACCAAACAATGTGGTTCTGTATTGATTTGATATGTTGTATGATTTTTTTTTCAATTAAATGTTTTCTGCTTTTACAGATATTATTCCCCTGGTTACTCCGAGACCTTGCTGGAAAGGATTGAAAAATATCAGCCAACATGACTTTATGAAACACTAAAACCACTCCATTTTAAACACTTGTGAAAAACAAAGAAGTAAATAAAATGTAATAAAGAAATTAGCAATAGCAATGAATTTAATTTAGTTTGTTTGTCTTGTTTCATGTACAATAGGCCTGTTAAACAAAAGTATATTTTATAGTGGTGTGGATTATTGTGTTTGTAATTAATCAGAGACAACAAAGCTTAGTTTAACCTATTTTTTAAAACTCTGTCTTTGAGAAATCTTGGTCTACAACACGAAAAGGTATTTTATCACATACACTCAGTTAT
Associated Phenotype:
Not determined