Busch Lab

ZMP

sipa1l1

Ensembl ID:
ENSDARG00000020134
ZFIN ID:
ZDB-GENE-030131-9909
Description:
signal-induced proliferation-associated 1-like protein 1 [Source:RefSeq peptide;Acc:NP_001025340]
Human Orthologue:
SIPA1L1
Human Description:
signal-induced proliferation-associated 1 like 1 [Source:HGNC Symbol;Acc:20284]
Mouse Orthologue:
Sipa1l1
Mouse Description:
signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43461 Nonsense Mutation detected in F1 DNA Not yet available
sa3071 Nonsense F2 line generated Not yet available
sa5675 Nonsense F2 line generated Not yet available
sa45702 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43461
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011018 Nonsense 293 1794 1 20
ENSDART00000114611 Nonsense 240 1715 1 20
Genomic Location (Zv9):
Chromosome 20 (position 28723311)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28794524
GRCz11 20 28697403
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAGAAAGGGAAAAACAAATGAAAAGGCGCTCAAAGTCAGAAACTGGT[G/T]GAGAGTCCATATTTCGAAAGCTGCGGAGTGTCAAAGCTGAAGGCGATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3071
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011018 Nonsense 1025 1794 8 20
ENSDART00000114611 Nonsense 972 1715 8 20
ENSDART00000011018 Nonsense 1025 1794 8 20
ENSDART00000114611 Nonsense 972 1715 8 20
Genomic Location (Zv9):
Chromosome 20 (position 28706591)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28777804
GRCz11 20 28680683
KASP Assay ID:
554-2905.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGATTAGTGGAAATTTGCAAGGTGGCTGTGGCAACACTTTCGCACGAG[C/T]AGATGATAGACCTGCTCCGCACATCAGTTACTGTAAAAGTTGTCATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5675
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011018 Nonsense 1025 1794 8 20
ENSDART00000114611 Nonsense 972 1715 8 20
ENSDART00000011018 Nonsense 1025 1794 8 20
ENSDART00000114611 Nonsense 972 1715 8 20
Genomic Location (Zv9):
Chromosome 20 (position 28706591)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28777804
GRCz11 20 28680683
KASP Assay ID:
554-2905.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGATTAGTGGAAATTTGCAAGGTGGCTGTGGCAACACTTTCGCACGAG[C/T]AGATGATAGACCTGCTCCGCACATCAGTTACTGTAAAAGTTGTCATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011018 Essential Splice Site 1721 1794 19 20
ENSDART00000114611 Essential Splice Site 1642 1715 19 20
Genomic Location (Zv9):
Chromosome 20 (position 28680267)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28751480
GRCz11 20 28654359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATATTGTCTAAGTGTCTTGCATTTTGACCTTTCTCTTGTTCTCCTTTT[A/C]GTGAGGGGCCTTCAAGCTACGGTGGGAAGGTTTCTCAGCTGGAGGCTTTG
Associated Phenotype:
Not determined