Busch Lab

ZMP

zgc:92851

Ensembl ID:
ENSDARG00000020133
ZFIN ID:
ZDB-GENE-040718-197
Description:
Jun dimerization protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGM8]
Human Orthologue:
JDP2
Human Description:
Jun dimerization protein 2 [Source:HGNC Symbol;Acc:17546]
Mouse Orthologue:
Jdp2
Mouse Description:
Jun dimerization protein 2 Gene [Source:MGI Symbol;Acc:MGI:1932093]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4110
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014166 Nonsense 33 156 2 4
ENSDART00000143530 Nonsense 33 110 1 2
Genomic Location (Zv9):
Chromosome 20 (position 46841822)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46687105
GRCz11 20 46590825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCCAGCGTCGGTCCTCTGGCCGGTTTTCCCGCCACCACACTGACGGAG[C/T]AACTCAAACTGGCGGAACTTTACCGTCTCGGGACGGTTCTTTCTCCGTTA
Associated Phenotype:
Not determined