Busch Lab

ZMP

fnbp1l

Ensembl ID:
ENSDARG00000020131
ZFIN ID:
ZDB-GENE-040801-155
Description:
formin-binding protein 1-like [Source:RefSeq peptide;Acc:NP_001003634]
Human Orthologue:
FNBP1L
Human Description:
formin binding protein 1-like [Source:HGNC Symbol;Acc:20851]
Mouse Orthologue:
Fnbp1l
Mouse Description:
formin binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1925642]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34354 Nonsense Mutation detected in F1 DNA Not yet available
sa41155 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34355 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34354
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Nonsense 124 548 5 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15573727)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15019071
GRCz11 8 15056776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGATCAACAGCATCTTCAGGAGGGACGGAAGGCCCAGCAGTA[T/A]CTAGACCAGTGCTGGAAACACATGGACAATGTGAGTCATTTTAGCGTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41155
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Essential Splice Site 169 548 6 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15578833)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15024177
GRCz11 8 15061882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGAGGTTAGACAATGACATCAACGCCACAAAGTCAGAAGTCGAAAAG[G/A]TATTCCTGTTCTTCACTTGAATTCTTACAGTTATTGACTGAATCTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34355
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Nonsense 343 548 10 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15587171)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15032515
GRCz11 8 15070220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTACAGGCGCCAACACTAGAGGATCTCAGCCACCTTCCCCCTGAA[C/T]AGAGACGCAAAAAACTACAACAGCGGATCGATGAGCTGAATAAAGAACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5472
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045038 Essential Splice Site 442 548 None 14

The following transcripts of ENSDARG00000020131 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15589275)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15034619
GRCz11 8 15072324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCGGTCCAGTGCAGATGTAAACCATCACGCTCCGCACGGAAGAGAGAGG[T/A]CTGGGTTTCCTCACTACATTATCTGCATTCTCAACACAGATGGCCTGTCT
Associated Phenotype:
Not determined