Busch Lab

ZMP

sars2

Ensembl ID:
ENSDARG00000020115
ZFIN ID:
ZDB-GENE-040426-1616
Description:
seryl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_957473]
Human Orthologue:
FBXO17
Human Description:
F-box protein 17 [Source:HGNC Symbol;Acc:18754]
Mouse Orthologue:
Sars2
Mouse Description:
seryl-aminoacyl-tRNA synthetase 2 Gene [Source:MGI Symbol;Acc:MGI:1919234]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39039 Nonsense Mutation detected in F1 DNA Not yet available
sa42502 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39038 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39039
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Nonsense 20 510 1 16
Genomic Location (Zv9):
Chromosome 15 (position 13554915)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14706796
GRCz11 15 14642753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGCAAGGGTAGCTTCACGGGTTTGCTCTTTCTATCTGCTTTTGTCCT[C/A]GAGACACGGTGTCAGCAGTGGCTGCAGATGGTCCGGCCGGTCCTGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42502
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Essential Splice Site 121 510 2 16
Genomic Location (Zv9):
Chromosome 15 (position 13554004)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14707707
GRCz11 15 14643664
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGAAGGCAGAAAGCAAGTGGTCAGTTCTACAGTCCGTGAGCTTGTGG[T/C]AAGTGTACGCACACATTGGTAACACTTTACAATAAGGTTGTATTAGTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4596
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Essential Splice Site 131 510 3 16
Genomic Location (Zv9):
Chromosome 15 (position 13549021)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14712690
GRCz11 15 14648647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCACATTTTATTTTACAGGGTAAACACGACAAATCYACCTTGTCTAGTG[T/C]AAGTTCCAGCTATTTATTTATTTATTTATTTATTTATTAAATGTAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027424 Essential Splice Site 472 510 15 16
Genomic Location (Zv9):
Chromosome 15 (position 13531193)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14730518
GRCz11 15 14666475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTATTCCACGTACCATCATTGCTATTTTGGAGACATACCAAACCAAGG[T/C]ACCATTTAGAGAAAACTTGTATGAAACGCTTTTTTTATTGCCAATGTGTG
Associated Phenotype:
Not determined