Busch Lab

ZMP

calrl

Ensembl ID:
ENSDARG00000020103
ZFIN ID:
ZDB-GENE-030131-9907
Description:
calreticulin like [Source:RefSeq peptide;Acc:NP_958873]
Human Orthologue:
CALR
Human Description:
calreticulin [Source:HGNC Symbol;Acc:1455]
Mouse Orthologue:
Calr
Mouse Description:
calreticulin Gene [Source:MGI Symbol;Acc:MGI:88252]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19907 Nonsense Available for shipment Available now
sa25938 Nonsense Mutation detected in F1 DNA Not yet available
sa38361 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19907
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025570 Nonsense 90 417 3 9
Genomic Location (Zv9):
Chromosome 2 (position 55844059)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55669548
GRCz11 2 55793393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGTTTCTACGCCACCTCTGTCCGCTTCGAGCCCTTTAGCAATGAGGGC[A/T]AAACACTGGTGATCCAGTTTACGGTTAAACACGAGCAGAAGATCGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25938
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025570 Nonsense 102 417 3 9
Genomic Location (Zv9):
Chromosome 2 (position 55844095)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55669512
GRCz11 2 55793357
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGCAATGAGGGCAAAACACTGGTGATCCAGTTTACGGTTAAACACGAG[C/T]AGAAGATCGACTGTGGAGGCGGATACGTTAAAGTCTTCCCAGCTGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38361
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025570 Essential Splice Site 273 417 6 9
Genomic Location (Zv9):
Chromosome 2 (position 55849455)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55664152
GRCz11 2 55787997
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGGATGGAGAGTGGGAGCCTGCCATGATCCCTAACCCCGAGTACAAGG[T/A]ACAGATTCACATGCTATTCACACGCTACTAAAAAGTAAAAGTAAATTATT
Associated Phenotype:
Not determined