Busch Lab

ZMP

neil3

Ensembl ID:
ENSDARG00000020079
ZFIN ID:
ZDB-GENE-041114-18
Description:
endonuclease VIII-like 3 [Source:RefSeq peptide;Acc:NP_001007336]
Human Orthologue:
NEIL3
Human Description:
nei endonuclease VIII-like 3 (E. coli) [Source:HGNC Symbol;Acc:24573]
Mouse Orthologue:
Neil3
Mouse Description:
nei like 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:2384588]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35732 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35732
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015761 Nonsense 554 568 10 10
ENSDART00000123343 Nonsense 563 577 10 10

The following transcripts of ENSDARG00000020079 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37648601)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36087928
GRCz11 14 36428242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAACTTCTACACATGCCCAGTTAAAATGGGCAAGCAGTGTAACTTCTTT[C/T]AGTGGGCTGAAAATGGCCCTGGCATCTCAATTCTGCCTGGCTGCTGAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3892
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015761 Nonsense 555 568 10 10
ENSDART00000123343 Nonsense 564 577 10 10

The following transcripts of ENSDARG00000020079 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37648606)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36087933
GRCz11 14 36428247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTACACATGCCCAGTTAAAATGGGCAAGCAGTGTAACTTCTTTCAGTG[G/A]GCTGAAAATGGCCCTGGCATCTCAATTCTGCCTGGCTGCTGAGTCCACAG
Associated Phenotype:
Not determined