Busch Lab

ZMP

bmpr2b

Ensembl ID:
ENSDARG00000020057
ZFIN ID:
ZDB-GENE-070618-2
Description:
bone morphogenetic protein receptor type-2 [Source:RefSeq peptide;Acc:NP_001034896]
Human Orthologue:
BMPR2
Human Description:
bone morphogenetic protein receptor, type II (serine/threonine kinase) [Source:HGNC Symbol;Acc:1078]
Mouse Orthologue:
Bmpr2
Mouse Description:
bone morphogenic protein receptor, type II (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41374 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34578 Nonsense Mutation detected in F1 DNA Not yet available
sa41375 Nonsense Mutation detected in F1 DNA Not yet available
sa5781 Nonsense F2 line generated Not yet available
sa2507 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa41374
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Essential Splice Site 147 1071 3 13
ENSDART00000125961 Essential Splice Site 147 1071 3 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13310152)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13062717
GRCz11 9 13033920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCAACTTCACAGAGAACTGGGTGCCCAGTCCCACCAGCACTGCCAACC[G/A]TAAGTCCTACAAACGCAGCATCTCTAGACTTCATCTGAAAGCCCCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34578
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 516 1071 11 13
ENSDART00000125961 Nonsense 516 1071 11 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13381491)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13134056
GRCz11 9 13105259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGACAGCGCAGTGTGCAGAGGAGCGTATGGCAGAACTGCTGCTGATTT[G/A]GGAAAGGAACAAACCTGTCAGTCCCACCATCAATCCCATGAGCACAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41375
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 773 1071 12 13
ENSDART00000125961 Nonsense 773 1071 12 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13383371)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13135936
GRCz11 9 13107139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACAGCAGAATCTCCCCAAGAGGCCCACTAGCTTACCCCTCAACACC[A/T]AAAATCCTGGTAGGGAGTCTTCGTCGTCTCGATTGAAATTCGGGAAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5781
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13387169)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13139734
GRCz11 9 13110937
KASP Assay ID:
554-3063.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGAGAAGATTAAAAAACGTGTGAAGACWCCTTATTCGTTGAAAAGATG[G/A]CGTCCTTCCACATGGGTCGTCTCCACTGATACACTAGAYGGAGAGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2507
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13
ENSDART00000002334 Nonsense 1003 1071 13 13
ENSDART00000125961 Nonsense 1003 1071 13 13

The following transcripts of ENSDARG00000020057 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13387169)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13139734
GRCz11 9 13110937
KASP Assay ID:
554-3063.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGAGAAGATTAAAAAACGTGTGAAGACWCCTTATTCGTTGAAAAGATG[G/A]CGTCCTTCCACATGGGTCGTCTCCACTGATACACTAGAYGGAGAGGTGAA
Associated Phenotype:
Not determined