Busch Lab

ZMP

ahr1a

Ensembl ID:
ENSDARG00000020046
ZFIN ID:
ZDB-GENE-020531-2
Description:
aryl hydrocarbon receptor 1 [Source:RefSeq peptide;Acc:NP_571103]
Human Orthologue:
AHR
Human Description:
aryl hydrocarbon receptor [Source:HGNC Symbol;Acc:348]
Mouse Orthologue:
Ahr
Mouse Description:
aryl-hydrocarbon receptor Gene [Source:MGI Symbol;Acc:MGI:105043]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa1410 Nonsense Available for shipment Available now
sa28637 Nonsense Mutation detected in F1 DNA Not yet available
sa16655 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28638
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Nonsense 28 807 1 11
ENSDART00000049830 Nonsense 29 808 2 12
ENSDART00000136461 Nonsense 11 790 1 10
Genomic Location (Zv9):
Chromosome 16 (position 22125618)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20232061
GRCz11 16 20037880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCTGTTTCTTTGGAGATTATGAGCTCCAGTAATATTTATGCAAGTCGC[A/T]AAAGGAGGAAACCTGTCCAGAAAAGGTAATAGTTTTTATTTTATATTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1410
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Nonsense 179 807 5 11
ENSDART00000049830 Nonsense 180 808 6 12
ENSDART00000136461 Nonsense 162 790 5 10
Genomic Location (Zv9):
Chromosome 16 (position 22111742)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20218185
GRCz11 16 20024004
KASP Assay ID:
554-1331.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGTGTGTATGAACTCATTCATACTGAAGACCGGCATGAGTTTCAGAGA[C/T]AGCTCCRCTGGGCCCTCWACCCTGGCTTTACCCCAGACTCTAGACAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28637
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Nonsense 295 807 7 11
ENSDART00000049830 Nonsense 296 808 8 12
ENSDART00000136461 Nonsense 278 790 7 10
Genomic Location (Zv9):
Chromosome 16 (position 22107546)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20213989
GRCz11 16 20019808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCCATACTGGAGATACGCACCAAGAACTTAATGTTCAAAACCAAGTA[T/A]AAGCTGGATTTCACACCTATTGCGTGTGACACAAAGTAAGAAATTAGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4653
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Nonsense 320 807 8 11
ENSDART00000049830 Nonsense 321 808 9 12
ENSDART00000136461 Nonsense 303 790 8 10
Genomic Location (Zv9):
Chromosome 16 (position 22106865)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20213308
GRCz11 16 20019127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTCCCRCAGTTGGAATTTTGTTCTTGGCTACACAGAGGCAGAGCTCTG[T/A]AAWAGTGGTTCAGGCTATCAGTTCATCCATGCAGCTGAYATGATGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16655
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019024 Essential Splice Site 391 807 9 11
ENSDART00000049830 Essential Splice Site 392 808 10 12
ENSDART00000136461 Essential Splice Site 374 790 9 10
Genomic Location (Zv9):
Chromosome 16 (position 22105369)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20211812
GRCz11 16 20017631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAAAAATGGGCARCCAGATTGCATCATCACCTCKCACAGAGTCATAAC[G/A]TATGCACTTATTTTTGTCTTTGCTATTTATTTGGGKTTTTTTTTTNNTATT
Associated Phenotype:
Not determined