Busch Lab

ZMP

si:dkey-225d17.3

Ensembl ID:
ENSDARG00000020028
ZFIN ID:
ZDB-GENE-081105-17
Description:
Novel protein similar to vertebrate carbamoyl-phosphate synthetase 1, mitochondrial (CPS1) [Source:U
Human Orthologue:
CPS1
Human Description:
carbamoyl-phosphate synthase 1, mitochondrial [Source:HGNC Symbol;Acc:2323]
Mouse Orthologue:
Cps1
Mouse Description:
carbamoyl-phosphate synthetase 1 Gene [Source:MGI Symbol;Acc:MGI:891996]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa41493 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7635 Missense Mutation detected in F1 DNA Not yet available
sa44709 Nonsense Mutation detected in F1 DNA Not yet available
sa34714 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18960 Nonsense Mutation detected in F1 DNA Not yet available
sa10807 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Essential Splice Site 68 1482 2 38
Genomic Location (Zv9):
Chromosome 9 (position 40082114)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39220010
GRCz11 9 39029805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGATCAGTCTGCAGCTGGAGAGCTGGTCTTCAACACAGGACTAGTTGG[G/A]TGAGAAGGCATCCTCTGAATATGGTCATGCATAAATATATTGTTTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Missense 138 1482 4 38
Genomic Location (Zv9):
Chromosome 9 (position 40083768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39221664
GRCz11 9 39031459
KASP Assay ID:
554-4361.1 (used for ordering genotyping assays)
KASP Sequence:
GGTTCAGGATTATAGTGCTGAGTACAGCCACTGGAACTCTGTGAAATCCT[T/C]AGCACAGTGGCTTCAAGAGGAGAAGGTGTGTTTATCTTAATAAATGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44709
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Nonsense 959 1482 24 38
Genomic Location (Zv9):
Chromosome 9 (position 40116404)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39254300
GRCz11 9 39064095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTAATTATCCAATTTTTCTTTTTGTCCTTGTCGACAGGAGCATGATT[T/A]GGATTTTAAGGACCATGGCACCATGGTTGTTGGTTGCGGTCCATATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Essential Splice Site 1150 1482 28 38
Genomic Location (Zv9):
Chromosome 9 (position 40150386)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39288282
GRCz11 9 39098077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAGGATGAGATGAAACGTTTCCTGGAGGAAGCCACACAGGTTTCACAG[G/A]TGAGCTCTGAAGATTTAGCCATTTGGACCTTTGCCACAAAAAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18960
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Nonsense 1161 1482 29 38
ENSDART00000004742 Nonsense 1161 1482 29 38
Genomic Location (Zv9):
Chromosome 9 (position 40152210)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39290106
GRCz11 9 39099901
KASP Assay ID:
2260-2234.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCATTTTCTCTAAAACAGGATCATCCTGTGGTCATCACCAAATTCATC[C/T]GAGGTGCCAGAGAGGTGGAGGTTGATGCGGTGGCCAGGATGGGCAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Nonsense 1161 1482 29 38
ENSDART00000004742 Nonsense 1161 1482 29 38
Genomic Location (Zv9):
Chromosome 9 (position 40152210)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39290106
GRCz11 9 39099901
KASP Assay ID:
2260-2234.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCATTTTCTCTAAAACAGGATCATCCWGTGGTCATCACCAAATTCATC[C/T]GAGGTGCCAGAGAGGTGGAGGTTGATGCGGTGGCCAGGATGGGCAAGGTA
Associated Phenotype:
Not determined