Busch Lab

ZMP

bmp2k

Ensembl ID:
ENSDARG00000020009
ZFIN ID:
ZDB-GENE-041212-72
Description:
BMP-2-inducible protein kinase isoform 2 [Source:RefSeq peptide;Acc:NP_001008644]
Human Orthologues:
BMP2K, BMP2KL
Human Descriptions:
BMP2 inducible kinase [Source:HGNC Symbol;Acc:18041]
BMP2 inducible kinase-like [Source:HGNC Symbol;Acc:17080]
Mouse Orthologue:
Bmp2k
Mouse Description:
BMP2 inducible kinase Gene [Source:MGI Symbol;Acc:MGI:2155456]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6995 Nonsense Mutation detected in F1 DNA Not yet available
sa40519 Nonsense Mutation detected in F1 DNA Not yet available
sa12724 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6995
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Nonsense 48 645 1 15
Genomic Location (Zv9):
Chromosome 5 (position 40700366)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38499756
GRCz11 5 39099909
KASP Assay ID:
554-5144.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTGTTTGCTGTCGGTCGATACCAAGTGACTGTGGAGGAGCTTATCGCT[G/T]AAGGTAAATGCATGCACTGGATTTAGGCCAAAGAAAAGATYATGGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40519
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Nonsense 574 645 14 15
Genomic Location (Zv9):
Chromosome 5 (position 40743055)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38542445
GRCz11 5 39142598
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGTCATGAGCCCCCCTCCACAGACCGTCAGCAACCCTCCTGATATGT[C/A]AAGCTGGAACCCCTTTGGAGAAGATAATTTCTCTAAACTCACCGAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12724
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006079 Essential Splice Site 603 645 14 15
Genomic Location (Zv9):
Chromosome 5 (position 40743143)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38542533
GRCz11 5 39142686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCACCGAAGAGGAGCTTCTCRATCGAGAATTCGACCTTCTWAGAGCAAG[C/T]AAGTGTCTCTGTTTATTTCTGCACAACCTGACCANNCTCTCTCTCTCCTCTA
Associated Phenotype:
Not determined