Busch Lab

ZMP

rad23a

Ensembl ID:
ENSDARG00000020001
ZFIN ID:
ZDB-GENE-040808-59
Description:
UV excision repair protein RAD23 homolog A [Source:RefSeq peptide;Acc:NP_001003739]
Human Orthologue:
RAD23A
Human Description:
RAD23 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:9812]
Mouse Orthologue:
Rad23a
Mouse Description:
RAD23a homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:105126]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa30806 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30805 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39696 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39697 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32770 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
Genomic Location (Zv9):
Chromosome 1 (position 52616187)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51487136
GRCz11 1 52121261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACGAGACGACCCTCCGGCTACGGTCTCTCCTGCACGCAGTCCTGACGG[G/A]TTAGACACAAGACAAATAATTTAACTAGACATTTTTCTGTGTGGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30805
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
Genomic Location (Zv9):
Chromosome 1 (position 52616187)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51487136
GRCz11 1 52121261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACGAGACGACCCTCCGGCTACGGTCTCTCCTGCACGCAGTCCTGACGG[G/A]TTAGACACAAGACAAATAATTTAACTAGACATTTTTCTGTGTGGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39696
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
Genomic Location (Zv9):
Chromosome 1 (position 52616187)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51487136
GRCz11 1 52121261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACGAGACGACCCTCCGGCTACGGTCTCTCCTGCACGCAGTCCTGACGG[G/A]TTAGACACAAGACAAATAATTTAACTAGACATTTTTCTGTGTGGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
ENSDART00000041265 Essential Splice Site 140 362 3 10
Genomic Location (Zv9):
Chromosome 1 (position 52616187)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51487136
GRCz11 1 52121261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACGAGACGACCCTCCGGCTACGGTCTCTCCTGCACGCAGTCCTGACGG[G/A]TTAGACACAAGACAAATAATTTAACTAGACATTTTTCTGTGTGGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32770
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041265 Nonsense 260 362 7 10
Genomic Location (Zv9):
Chromosome 1 (position 52610757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51481706
GRCz11 1 52115831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCCAGCAGAACCCGTCGCTACTGCCGGCGCTGCTGCAACAGCTGGGT[C/T]AGGAGAATCCCGAGCTCCTGCAGGTCTGCAAACTCACACACATGCACACA
Associated Phenotype:
Not determined