Busch Lab

ZMP

bmp4

Ensembl ID:
ENSDARG00000019995
ZFIN ID:
ZDB-GENE-980528-2059
Description:
bone morphogenetic protein 4 [Source:RefSeq peptide;Acc:NP_571417]
Human Orthologue:
BMP4
Human Description:
bone morphogenetic protein 4 [Source:HGNC Symbol;Acc:1071]
Mouse Orthologue:
Bmp4
Mouse Description:
bone morphogenetic protein 4 Gene [Source:MGI Symbol;Acc:MGI:88180]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36537 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36537
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075150 Nonsense 355 400 4 4
ENSDART00000126820 Nonsense 354 391 7 7
Genomic Location (Zv9):
Chromosome 17 (position 51114684)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50505501
GRCz11 17 50584570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGATCATCTCAACTCCACCAATCACGCTATCGTACAGACACTGGTGAACT[C/A]GGTGAACACCAATATCCCCAAAGCCTGCTGCGTGCCCACTGAGCTCAGCG
Associated Phenotype:
Not determined