Busch Lab

ZMP

smarcd3b

Ensembl ID:
ENSDARG00000019969
ZFIN ID:
ZDB-GENE-080509-2
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3b
Human Orthologue:
SMARCD3
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 [S
Mouse Orthologue:
Smarcd3
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Ge

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12626 Essential Splice Site Available for shipment Available now
sa12191 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27019
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006724 Nonsense 27 476 2 13
Genomic Location (Zv9):
Chromosome 7 (position 44188004)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41178304
GRCz11 7 41458377
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATAAATATCTCCACCTCACCTTCTTATTTTTTGTCATTTTTTTTTCAG[C/T]GACCTGGCATGCCATCAGGAGCACGAATGCCACATCAAGGGGCTCCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12626
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006724 Essential Splice Site 90 476 2 13
Genomic Location (Zv9):
Chromosome 7 (position 44187812)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41178112
GRCz11 7 41458185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCACAGCAGCAGATCCAGCAGCAGGCCGTACAGAACCGAAACAGAAAG[T/A]GAGTATAATACGACATGCTCAAGAAGATCCTATAAAGATACAGTAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12191
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006724 Nonsense 310 476 9 13
Genomic Location (Zv9):
Chromosome 7 (position 44174953)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41165253
GRCz11 7 41445326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAWTGAARARCTGTNNTTTTGCCTTCATCTCCTCTCATAGATCTTTGACTG[T/A]CCACGTCTGAARTTCTCTGAAATTCCCCAGCGCCTCACCAACCTTTTACT
Associated Phenotype:
Not determined