Busch Lab

ZMP

als2cr8

Ensembl ID:
ENSDARG00000019950
ZFIN ID:
ZDB-GENE-070912-172
Description:
Novel protein similar to human amyotrophic lateral sclerosis 2 (Juvenile) chromosome region, candida
Human Orthologue:
ALS2CR8
Human Description:
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 [Source:HGNC Symbol;Acc:14
Mouse Orthologue:
Carf
Mouse Description:
calcium response factor Gene [Source:MGI Symbol;Acc:MGI:2182269]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa21447 Essential Splice Site Available for shipment Available now
sa9357 Nonsense Mutation detected in F1 DNA Not yet available
sa18940 Nonsense Mutation detected in F1 DNA Not yet available
sa41376 Nonsense Mutation detected in F1 DNA Not yet available
sa15446 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21447
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Essential Splice Site 191 657 5 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Essential Splice Site 195 477 5 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13510107)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13262672
GRCz11 9 13233875
KASP Assay ID:
554-6613.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCCACCAGGGTCACCAAACTGGGCTCTCAGACTGCGCGGGTGTGAGG[T/C]TTGTCCAGTGACAAGTTTATAGGATTTAAGATTTACAAAATTAAGTTTAT
Long Flanking Sequence:
AGGGAATGGACAAATATTTGGCGTCCCGTCTGTGCCTTTAAGTGGCGCTCAGATGTTACTACCTCATGGTCAACTTTTGAATGTAGCAAAGTCATCAGGTTATTAATTGTATCATATTTGAATTTAATTGATTATTTCTCTTCTAAAATAATACAAAAATGGTTGATTTACAGTTCTGCCATTTGTTCTGTTCTGTTAAACAGGCGTCTTTGTGGAAAAAAGACAGCAGCCTGTCATCACAACCATAAAAGAGAATGACGGTGCTCATAGTTTACCTGCAACAACGGCTCAGAATATCACTGCTATTAAAATTCAGAAGAAAAGGTCAGTGACACAATTTTATACTGTCCGATTTTAATCGTTGGTTCAGAGTGTGCCTTATTTGTTGAATAAAAAATGTTTTCTTGTCTCTTTCAGTTTTCCTGATGTATTTGAGCCCCCGGTAAAGCCACTGCCACCAGGGTCACCAAACTGGGCTCTCAGACTGCGCGGGTGTGAGG[T/C]TTGTCCAGTGACAAGTTTATAGGATTTAAGATTTACAAAATTAAGTTTATGTTTAATATTTAATAAATTTAATCAAATTTAATTTAATATTATATTATATATGCAAAAATTAAGTGTACATGTAGGACCATTACGGTTGTTTTGTTTTCCTGCATTGATTTAATTTTATGTTAGTTGACCATATATTGTCCACGAGTAATCATTTTAATTTTTAAGATATTCTTTTAATATTCTCATGTTTTAACTGATGATTCTTGATACTGTATTACAGCTTTTCTTGCACTATTTATGTGTTATTTTCTTTTTACTCTTTTTAAAATTGTTTAATACATTTGAATCAGTTGTTAATCATTTTAATTTTGTTTTTATTTCTTATTACTTATTTTGTAATGCTTTTTAATCCTCATTTTGTGTAAAGCACTTTGAACTACCAGTTATGAAATGTGCTATACAAATAAACTTGTCTTATGTTACAGTGGAATATAATTACACATAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9357
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13511504)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13264069
GRCz11 9 13235272
KASP Assay ID:
2260-1593.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGCTAAACCTGCCACCAGGCTYATGTGGAAATCACAGTATGTGCCCTA[C/A]GATGGCATTCCCTTCGTTAATGCAGGTAATCTGGTATGACTGTTATGAAT
Long Flanking Sequence:
CCTCTTTAAAAAAGGGGAGCACAATCTCATTTAATTTTAAAACGAATTTAAAAGGGTCAAAGAGTTATAAAACATTATTTGTGTGATATTTTTCACCTACGCAATCTAGAGACTTGAGAGACTTAATTTACATTTTGTAAACAGGGGCAAAATTGGTCTCCTTTAAACAATAAAAAAGGAAAGTGTAATATTCATGGGGAAAATAATGCAATAAAATTGATGATGTGTAAAGATGAAAAATCTAAGACTCCTTTGTCTAAAAAACCCGTTTCCAGCAAGATGGTGCAATGATGTCAAGCTAATGAGTTTTGTTAAATCTGTATTGTGTGTGAGCAGAAGATCGGGGACTCGTACCGTGGTTACTGTAACACAGAGACCGAGCTGGAGGCTGTTCTGCTTCAACATAAGCAGCAGACCCACGCTGTTTTTGGCACCCGTCAGTCCCCATCCCCAGCTAAACCTGCCACCAGGCTTATGTGGAAATCACAGTATGTGCCCTA[C/A]GATGGCATTCCCTTCGTTAATGCAGGTAATCTGGTATGACTGTTATGAATTTATGTCAGATATACTCCTGTATGAATGCCATTTAGTGTTCATTTTAATGCCAGAATTGCGACTTGAATTGTTACTTCACTCTGACATTTTGTAATTTAAATGTTATGTGTAAGTGAAATGTTAAGTACAGTTAGAACTTTTATGTGGCTACATATGCTGAGGTGTGTGAATTTACAATGGTAGTTGATTTGAATTTAATGGTGCTTTAAAATGTCCTTAAGTCTTTGAATTGGCTGTTGATGAAAGAGTGGGAACCCTGTTCAAGATTAGAGGCCTGTGATTCTCTGATCTTTAGTTGATATTTGTTAGCTTTGAGGTCATCTGTATGCTAGTGGTTGACCAAACCAGTAGATTAAGATTGAGGAGATTCACCACTATTTGAGGGTAACCATTTTTTTTTTCTTTAATAGAAATGTTATACGTTTTCTTTTAACAGTTATAGTAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10
ENSDART00000017932 Nonsense 246 657 6 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 250 477 6 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13511504)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13264069
GRCz11 9 13235272
KASP Assay ID:
2260-1593.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCTAAACCTGCCACCAGGCTTATGTGGAAATCACAGTATGTGCCCTA[C/A]GATGGCATTCCCTTCGTTAATGCAGGTAATCTGGTATGACTGTTATGAAT
Long Flanking Sequence:
CCTCTTTAAAAAAGGGGAGCACAATCTCATTTAATTTTAAAACGAATTTAAAAGGGTCAAAGAGTTATAAAACATTATTTGTGTGATATTTTTCACCTACGCAATCTAGAGACTTGAGAGACTTAATTTACATTTTGTAAACAGGGGCAAAATTGGTCTCCTTTAAACAATAAAAAAGGAAAGTGTAATATTCATGGGGAAAATAATGCAATAAAATTGATGATGTGTAAAGATGAAAAATCTAAGACTCCTTTGTCTAAAAAACCCGTTTCCAGCAAGATGGTGCAATGATGTCAAGCTAATGAGTTTTGTTAAATCTGTATTGTGTGTGAGCAGAAGATCGGGGACTCGTACCGTGGTTACTGTAACACAGAGACCGAGCTGGAGGCTGTTCTGCTTCAACATAAGCAGCAGACCCACGCTGTTTTTGGCACCCGTCAGTCCCCATCCCCAGCTAAACCTGCCACCAGGCTTATGTGGAAATCACAGTATGTGCCCTA[C/A]GATGGCATTCCCTTCGTTAATGCAGGTAATCTGGTATGACTGTTATGAATTTATGTCAGATATACTCCTGTATGAATGCCATTTAGTGTTCATTTTAATGCCAGAATTGCGACTTGAATTGTTACTTCACTCTGACATTTTGTAATTTAAATGTTATGTGTAAGTGAAATGTTAAGTACAGTTAGAACTTTTATGTGGCTACATATGCTGAGGTGTGTGAATTTACAATGGTAGTTGATTTGAATTTAATGGTGCTTTAAAATGTCCTTAAGTCTTTGAATTGGCTGTTGATGAAAGAGTGGGAACCCTGTTCAAGATTAGAGGCCTGTGATTCTCTGATCTTTAGTTGATATTTGTTAGCTTTGAGGTCATCTGTATGCTAGTGGTTGACCAAACCAGTAGATTAAGATTGAGGAGATTCACCACTATTTGAGGGTAACCATTTTTTTTTTCTTTAATAGAAATGTTATACGTTTTCTTTTAACAGTTATAGTAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41376
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 372 657 9 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 376 477 9 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13515138)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13267703
GRCz11 9 13238906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCATGATGTGGAGACTGTAAACCTGCCTCCTCTTCCAGATCAGATCTG[C/A]TTCACAGAAGACCATCCTCATGAAGAGGAAGACACAGAAGAGCTGGGGTT
Long Flanking Sequence:
CATTTTGTTGACATTGATTTCGTTTGTCGACACTCAGCACAACTGCATTGTGGCCATTCTAAGTTCGAGTTCTGACTCGCAGACATTTCCCAATCCCATCCCCTTTCTCTCTATGACTTCTATGACAAGTAACTGTTAAAAGTATTTTGTTCATTGAATTTGTTAGATCAATTGAATTTGACAGCAAAGCTTTTTTTGATTTATTTATTGAACAATTCAATAAATCTGAATAGATAATTCTAATTCATTTAATTTTTTTATAAAAACTGTGGCACTATGTCAGCAACTTTAGTTTGTTTAGTTAATTGTCTATTTAAAAATGTGTAAAATATTGACGATCATCAGTTTACACAGATTTAATTCTCAATTCAACCAAATAATCTACTTCACTCATTTACTTACCTTTGTTCTAGGTATTACGTCCAGCTCCCTACAGAAAAAGCCCACCTGTACCATGATGTGGAGACTGTAAACCTGCCTCCTCTTCCAGATCAGATCTG[C/A]TTCACAGAAGACCATCCTCATGAAGAGGAAGACACAGAAGAGCTGGGGTTTCAAGCCATGCAGGACGTCCTTGTGGAGGATGGGGTATCCCTACCCGAGTCTCGACTACACCCGCTGGTGGCAGAGAAGATCTGTGAATTGGTGGCTCATGGTCATAACCAGGTCTACACCGTCCGCAAACAGCTCAGGTATGACCTTTGATGCTTACCAATCAGTTAGGATTTGCCTACAACTTGTTTACTGTAGCTCTTGTGAATGTCCTGGCAGGAGGTTTGTTGAACGTGAGATGTTCAAGTCAGAGGAAGTGCCTGAGAGACACAATCTGTGTTACTTTCCCACCGTCAATGACATCAAGAACCACATCCACGAGGCGCAGAAAACTCTTGGACCACTGGACGGTTCAGATAATGAGGTGTGGACAGAACACACTGTTTCTAAAGATCTGATCACATTCACCTAGTAGTGAAACTGTCGTTTGTAGTCATTTCAGTGCACACCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3738
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 390 657 9 14
ENSDART00000140269 None None 162 None 4
ENSDART00000141705 Nonsense 394 477 9 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13515190)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13267755
GRCz11 9 13238958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCACWGAAGACCATCCTCATGAAGAGGAAGACACAGAAGAGCTGGGGTTT[C/T]AAGCCATGCAGGACGTCCTTGTGGAGGATGGGGTATCCCTACCCGAGTCT
Long Flanking Sequence:
GCCATTCTAAGTTCGAGTTCTGACTCGCAGACATTTCCCAATCCCATCCCCTTTCTCTCTATGACTTCTATGACAAGTAACTGTTAAAAGTATTTTGTTCATTGAATTTGTTAGATCAATTGAATTTGACAGCAAAGCTTTTTTTGATTTATTTATTGAACAATTCAATAAATCTGAATAGATAATTCTAATTCATTTAATTTTTTTATAAAAACTGTGGCACTATGTCAGCAACTTTAGTTTGTTTAGTTAATTGTCTATTTAAAAATGTGTAAAATATTGACGATCATCAGTTTACACAGATTTAATTCTCAATTCAACCAAATAATCTACTTCACTCATTTACTTACCTTTGTTCTAGGTATTACGTCCAGCTCCCTACAGAAAAAGCCCACCTGTACCATGATGTGGAGACTGTAAACCTGCCTCCTCTTCCAGATCAGATCTGCTTCACAGAAGACCATCCTCATGAAGAGGAAGACACAGAAGAGCTGGGGTTT[C/T]AAGCCATGCAGGACGTCCTTGTGGAGGATGGGGTATCCCTACCCGAGTCTCGACTACACCCGCTGGTGGCAGAGAAGATCTGTGAATTGGTGGCTCATGGTCATAACCAGGTCTACACCGTCCGCAAACAGCTCAGGTATGACCTTTGATGCTTACCAATCAGTTAGGATTTGCCTACAACTTGTTTACTGTAGCTCTTGTGAATGTCCTGGCAGGAGGTTTGTTGAACGTGAGATGTTCAAGTCAGAGGAAGTGCCTGAGAGACACAATCTGTGTTACTTTCCCACCGTCAATGACATCAAGAACCACATCCACGAGGCGCAGAAAACTCTTGGACCACTGGACGGTTCAGATAATGAGGTGTGGACAGAACACACTGTTTCTAAAGATCTGATCACATTCACCTAGTAGTGAAACTGTCGTTTGTAGTCATTTCAGTGCACACCCATCCATTTTTGCAGAAAGGTGAAAAGGTTCCTAATTTTTTTTCATGTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15446
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017932 Nonsense 633 657 13 14
ENSDART00000140269 Nonsense 138 162 3 4
ENSDART00000141705 None None 477 None 10

The following transcripts of ENSDARG00000019950 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13522719)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13275284
GRCz11 9 13246487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAATKCTGGAGCTAATGGAGGAATCACACAGATCCTGCTGGAGGATGGA[C/T]AGGCTATYCCAGTCCAGATTGTGGAGCCGGCAAACATAGGTGAKTATATC
Long Flanking Sequence:
AAAACACAAAACGGCAATCTATTTTATAGAGATTATCTCTGCAGACCTTCGTGATTGTACTGCATGTCAGCGTCAACAGGTTTTTCCTAAACATTTGCCACTTCTGACTTTTTTAAATGCTAAAACTGGGCAAGACCAGCTCAGGTCATCAGTTGGCATGTAATTTGGTGGCCTTGAATCAGATTTATAGATGTTGTTTATGTTACCATTAGGAGCGCTTTTCTCTCATCTGATAGACCATTCAGCTCCAGCCGCCCTTGTGTCCAGTGGAAGACCCTGCTCAACCTTTAACAGCAGCACCAGAAGCCCAAGAGCTGTCCAGCCCTGCAGCCTCACAGCCTGCACTCCTGAGTCCATCCCAATTTCTCCAGTCTAGTCCCAGTGCTGGCGAAGGCAGGTCTGTGTGTGAGACCCCGACCCTGCTTGGCATGAACCAGCTAGTGAGTGTCTCTAATGCTGGAGCTAATGGAGGAATCACACAGATCCTGCTGGAGGATGGA[C/T]AGGCTATTCCAGTCCAGATTGTGGAGCCGGCAAACATAGGTGATTATATCAGAGGCTTTCACAACACTGGAATGTTCTCATAGTTCCTATGCAGGGTTTATAAGATCATGGAAAAGTCATGGAATTTTGACATGGCATTTTCCAGGCCTGGAAAAGTTTTGAAAAAACAGAAAAAGCCACAAGGGTTTGGAAAAATTCATGGAGATTACATTTAGTCATTTAGCAGACATTTTTATCCAAAGCGACTTGTCCAAAGCTGCGGTCAAACTAAAGCAGGGGTCAGGAACTTTTTTTCAGCAAAGAGCCATTTCTGATTTACTATATATATATATATATATATATATATATATATATATATATATATATATATGTAGTTGGATTGTTAGCATAATCTGATGGGTAGGATAAAATGTTAGGACACCCGAAACATGATATTACTCAGCGGTTATACCGAAAAAAGCATGAAACATCACTATTCAATTTACTACTACGTTCAGTTC
Associated Phenotype:
Not determined