Busch Lab

ZMP

zgc:85963

Ensembl ID:
ENSDARG00000019917
ZFIN ID:
ZDB-GENE-040516-6
Description:
hypothetical protein LOC407981 [Source:RefSeq peptide;Acc:NP_999977]
Human Orthologue:
EPB41L3
Human Description:
erythrocyte membrane protein band 4.1-like 3 [Source:HGNC Symbol;Acc:3380]
Mouse Orthologue:
Epb4.1l3
Mouse Description:
erythrocyte protein band 4.1-like 3 Gene [Source:MGI Symbol;Acc:MGI:103008]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39960 Nonsense Mutation detected in F1 DNA Not yet available
sa7313 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39960
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004431 Nonsense 118 838 4 29
Genomic Location (Zv9):
Chromosome 2 (position 59027563)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58085195
GRCz11 2 58571168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTAATCTGCAATTGCCTCTCTGGATATACCACTAACTGTACTTAAAAA[A/T]AAATAAATAAATAAAAATTACTAATGTTTTGCTTCTTACACTTTACACAC
Long Flanking Sequence:
CCAGACTGGACTATTGCAACTCTCTACTAGTCGGGCTTCCAGCTAACTCAATCAAACCTCTTCAGCTCTTCAGAACGCAGCAGCACGAGTGGTCTTTAATGAACCTAAACGAGCACATGTCACTCCGCTGCTCATCCGTTTGCACTGGCTGCCAGTTGCTGCTCGCATCAAATTCAAAGCTCTGGTGTTTGCTTACAAAGCGACTTCTGGCTTTGCTCCTTCTTATCTGCTCTCACTTCTGCAGATGTATGTGTCCTCCAGAAACTTGCGTTCTGTGAATGAACGTCGCCTCGTGGTTCATCCCAAAGAGGGAAGAAATCACTTTCCCGAACTCTCGCATTCAATCTGCCTAGTTGGTGGAATGAACTCCCTAACTGCATCAGAACGGCAGAGTCACTCGCTGTCTTCAAGAAACCACTAAAAACTCAACTATTTAGTCTCCGCTTCCCTTCCTAATCTGCAATTGCCTCTCTGGATATACCACTAACTGTACTTAAAAA[A/T]AAATAAATAAATAAAAATTACTAATGTTTTGCTTCTTACACTTTACACACCTGAAACTTGCCTACAGCACTTCTTCATTGTTGCTCTTAGTTATGTAAATTGCTTCCTTGTCCTCATTTGTAAGTAGCTTTGGATAAAAGTGTCTGCTAAATGACGTGTTACTCTTTATTTTAATTTCACAGGAACTTTAAAAGTAAGCCAAGTCTGCGGGAAAACAGTGGACTTGGCAACCCTAGACTGTGATTCCTGACTGTGATTTTCATTAGTTTTTGTAATGCAACTCTTGATGTTTCTTTTCCTCCAGAACTGGCTGGACGCCTCCAAAGAGATCAAGAAGCAGATCAGCAGTAGGTTTTCCCTCAAACACAAGTGCTTTTGTCTTCTTTCTCATCCGCAGGATCTGACAGTAGCTCTTGTTTTTCAGCTTCTCCCTGGAGCTTCGCCTTCAACGTGAAGTTTTATCCTCCAGATCCAGCGCAGCTCTCGGAGGACATCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7313
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004431 Essential Splice Site 742 838 26 29
Genomic Location (Zv9):
Chromosome 2 (position 58975100)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58032732
GRCz11 2 58518705
KASP Assay ID:
554-4948.1 (used for ordering genotyping assays)
KASP Sequence:
GTGATTCTGCAGTGATGTGAAGTGTGCTGTGTTTGCCCCAGAGTTCAGAG[G/A]TAAAGACTCCCTCTGCTGGTGAAAAACTAAAGYACATGAAGGCTCTCAAT
Long Flanking Sequence:
TGGAGGTAGATTAGTGTCGTCTAGTGGGGAAGTATGTGTATATGTAAAGGTATGTGTGTTTTTTTCTCTGTTGTCATTTTTCACTTTAAAAAAATGAAGTGCTTCTTGTTTTTAAGACTACTTTTTAGGTCTATAATTTGTTTTATGTGTAAAATTGCTGCCAAATACTACAAAATGTCAATGATATGTGTTTTATAATGTAATAACCCTAAATGAATGGATGGAATGATTATTTCTTGTTGGTTTATTTCTCGACTCACAGCTCTTTGATATTATGGTTGATGCAGTGTCAATAACGAATGCTTTCCTTCTATTTCTCCTAAATAATATTTGAGAATAGATTTAGTGTGTCCCATGAAGATTGACAGGTGCTCGTATTGAGGAAATATTTGTCTTGAAGCTTGCACACTCAAAAATGGGCTTTTCAGGCTTAGTATACGTAGGAGAATTGTGATTCTGCAGTGATGTGAAGTGTGCTGTGTTTGCCCCAGAGTTCAGAG[G/A]TAAAGACTCCCTCTGCTGGTGAAAAACTAAAGTACATGAAGGCTCTCAATGAGGCCATCGCTAGGGGAAGACGCTCCGCATTCATTCATAATGGAGAAGAAGATGCATTAAACTGTGCAGGAGCTGCCAAAGATGATCAGTTTCCAGTACAAACCCGTGAACATATCCATGATGAAAGCCCAGACATGATGTGTCTGGAGAAAGATGAAGAAATGCTGCAAATCTGGGTTCCAGAAAAGCAAAATATTGAGGATAACAATAAAAACGAGGAAACTGCGTTTGAAACACAATCTGAAAAACACAAAATCACTTCAGAAACCAAACAGAGTACTTCAAGAATTGAAAAAGTGGTGTCTCATGAAGATGATTTTGGTGCAAAACACCAAAACAGTGCGTCTGAAATCAAGAAATCCTCAGGTGAAACTCAGTCTGAAGAAGGAGAAGAAACTGGACCAAAACACCATGAAATTTCTGCTGGAAACCAAGAAATGTTCCCAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8102
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004431 Essential Splice Site 802 838 28 29
Genomic Location (Zv9):
Chromosome 2 (position 58971171)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58028803
GRCz11 2 58514776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGAAAARCGGATCGTCATCAGTGGAGATGCAGACATCGATCATGACCAG[G/A]TAAAACACAAACACACACACACACACACACACACYTGTCGAGCAGGAYAG
Long Flanking Sequence:
AAAAACACAGAAACGCCAACTGACCCAGTCGGGACTCGAACCAGTGACCTTCCTGCTGTGAGGCCACAGTGCAACACCACTCACATTTAGAATGTTTCAAAAAAAAGTGCTTTGTTAAAACTTGAATGTGTGTGTTTGTGTCCAACACAATCTCACGGCAATTTAACTTTTAGATTTGGTTAATTCGTATGAGTTTGTATGATCTCATTTGTACAATTTAGCATGATTTGCTCATCCCCCAATGATGGTTGGGTGTAGGGGCGGGGTTTGGTGTCACACCTTCTTTTTAAAATCGACTGAACTAATATGAAACCGTATCAATTGGCCACTAAACCGACAAAACGTAAAATACTTACGTTTCCTTGTGAGATCAGGCTTGAGTGTCACGTGCGTAACAGCACTGGTGTGTGTTTTCTCAGACGGTGAAGGACGGGATTTCAGAGACTCGCATCGAAAAACGGATCGTCATCAGTGGAGATGCAGACATCGATCATGACCAG[G/A]TAAAACACAAACACACACACACACACACACACACCTGTCGAGCAGGACAGAGCGAAGTCTTCAGTGCTGAAATCAGTGTTTCCACAGCAGCACAACTGGCAATATATTCAATTACTGTATGTGCTTCAATTATTTATTACGATCAGCTGTTTTTCTTTGACAGCACACAAATCTGCTTAGATTATTTTATTTTATTTGGATTTTACATTTAGATTTAGCATTTTCTTACATATTAAACCTGCATTGCACAGCCCTTTAGTGGACAGAAATTTAAAAAAACGTATATTTAATTGTATTATTTATTTAAATGATAATTAAAGGAATGTTTCTCAATTTTTTTATATTTTATAAAAAAATTAACAAATTAAAAAATTTTAATAAACTTTTTTTTTTATTTTTACAGATATTTAACATTTGTTTTGTAATTTTTTATTTATTTATTTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTTATATATTTA
Associated Phenotype:
Not determined