Busch Lab

ZMP

bsg

Ensembl ID:
ENSDARG00000019881
ZFIN ID:
ZDB-GENE-030131-9638
Description:
basigin [Source:RefSeq peptide;Acc:NP_937785]
Human Orthologue:
BSG
Human Description:
basigin (Ok blood group) [Source:HGNC Symbol;Acc:1116]
Mouse Orthologue:
Bsg
Mouse Description:
basigin Gene [Source:MGI Symbol;Acc:MGI:88208]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7493 Missense Mutation detected in F1 DNA Not yet available
sa5689 Essential Splice Site F2 line generated Not yet available
sa3178 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa7493
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015951 Missense 81 404 2 9
ENSDART00000105392 None None 287 None 8
ENSDART00000131131 None None 262 None 8
Genomic Location (Zv9):
Chromosome 22 (position 19157701)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18908636
GRCz11 22 18933614
KASP Assay ID:
554-4094.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAGATGAAATCATCACTCAGCTGTTTGATGGTGCAAGAGAGGATCGCG[T/A]TCACATCAACGCCACCTATATTGACCACGCCACCAGCTCGCTCATCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5689
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
Genomic Location (Zv9):
Chromosome 22 (position 19162989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18913924
GRCz11 22 18938902
KASP Assay ID:
554-3076.1 (used for ordering genotyping assays)
KASP Sequence:
ATCATCTTCGTCTACGAGAAGAGAAGAAAGCCTGATGAGATCAATGACGG[T/A]GCGTAACTCTTAACTGTTCGCGCCACAATGATTTCTCACTTACACTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3178
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
ENSDART00000015951 Essential Splice Site 377 404 6 9
ENSDART00000105392 Essential Splice Site 260 287 5 8
ENSDART00000131131 Essential Splice Site 235 262 5 8
Genomic Location (Zv9):
Chromosome 22 (position 19162989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18913924
GRCz11 22 18938902
KASP Assay ID:
554-3076.1 (used for ordering genotyping assays)
KASP Sequence:
ATCATCTTCGTCTACGAGAAGAGAAGAAAGCCTGATGAGATCAATGACGG[T/A]GCGTAACTCTTAACTGTTCGCGCCACAATGATTTCTCACTTACACTTTTC
Associated Phenotype:
Not determined