Busch Lab

ZMP

cnot3b

Ensembl ID:
ENSDARG00000019842
ZFIN ID:
ZDB-GENE-030131-5838
Description:
CCR4-NOT transcription complex, subunit 3b [Source:RefSeq peptide;Acc:NP_956134]
Human Orthologue:
CNOT3
Human Description:
CCR4-NOT transcription complex, subunit 3 [Source:HGNC Symbol;Acc:7879]
Mouse Orthologue:
Cnot3
Mouse Description:
CCR4-NOT transcription complex, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2385261]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa23456 Nonsense Available for shipment Available now
sa23455 Essential Splice Site Available for shipment Available now
sa9040 Nonsense Mutation detected in F1 DNA Not yet available
sa15689 Nonsense Available for shipment Available now
sa6547 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa10327 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23456
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 145 906 7 18
ENSDART00000081485 Nonsense 145 846 7 23
ENSDART00000136304 Nonsense 145 908 7 18
ENSDART00000136697 Nonsense 145 885 7 18
Genomic Location (Zv9):
Chromosome 19 (position 10898812)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10357351
GRCz11 19 10276276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTAGAACACAATAGACACATTGAATATGCAAGTGGACCAGTTTGAGAGC[G/T]AGGTTGAATCGCTTTCTGTCCAGACCAGGAAAAAGAAAGGCGACAAAGAG
Long Flanking Sequence:
CATAAAGTGAGAATCATCTCAGTCTGGTTTCTTGAACATGGCAATGCGTTCACTGAACTCAAATGGCCTCCACAGTCACCTGACCTCAATTCAATAGAGGACTTTTGGGATGTTGTGGACCGAGAGATTTGTATCATGGATGTGCAGCCAACAAATCTGCAGCAACTGGGTGATGCTATCATGTCAATATAGACCAGAGTCTCTTGGGGAATATTTTCAGTGGTCTGTTGAATCTATGCCACAAAGGATTAAGGCAGTTCTGAAGGCAAAAGGGGGTCCAACCCAGTACTAGTAAGATGTACCTAATAAAGTGGTCAGTGAGTGTGTCAGTCTCACTGCTGTGAATGTAATTTAGCAAAGAACAGCAATTGTTGATAAGAAATGTTTCAACTTGCATGTACCTATCGAAATATGTGCTCATTATCGTCTTTTGCTTTGTACCTTGATCCTTCTAGAACACAATAGACACATTGAATATGCAAGTGGACCAGTTTGAGAGC[G/T]AGGTTGAATCGCTTTCTGTCCAGACCAGGAAAAAGAAAGGCGACAAAGAGGTCAGTTACTGTTTCTCCACACTCCTTTATTCTCATTCTCTTTAGTTTTTACAATGTGCCTTTTGATGTGGGGTAGTCTATTCTAATATTTCAAGATCTGAGCTGAAAACTAAACGCTTGTTTGTTCAAGTCCAGCAAATGTTCATACATGAATGATTTACTTTGTTCGTCTAAATAAGGGGGGTTTTGGCCTTTCTGTAAACCAGTTAAAAAAAATCAAATTCATTATTGATGCTAAGCATATCTTTTTGGCACTTCATTTATGTTTGAAGTCGTCTTCTTAAAAGTAAAATTCATTACATTACAATACTTATTTTTTTCAAAACCGATTACAATACAGACTTCTTCACAATACATATTTTAGAAGCTGTTCTCTTAAGAATAAATTTCTGTCCTCTTTCTCCTGAACTTGCATACACCAAACTTAACAGTTTCATTGGGCTTTTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23455
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Essential Splice Site 234 906 8 18
ENSDART00000081485 Essential Splice Site 232 846 12 23
ENSDART00000136304 Essential Splice Site 234 908 8 18
ENSDART00000136697 Essential Splice Site 234 885 8 18
Genomic Location (Zv9):
Chromosome 19 (position 10896454)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10354993
GRCz11 19 10273918
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGAGGAGAACGAGTTCCTCTATGATGACCTTGATTTAGAGGAGATAC[G/T]TGAGTGCTTGAAAATGCTTGTCAGAAGGGAGTTTGTTTTTTTTTTTTGGT
Long Flanking Sequence:
GGACTGTTTATTTTAATTTAGCTTATTTCTATGCTGTTGGAAACACTGCAGGTGCATCAAGATGTTCTGTTGTTAATGTTTGCATATTAAGTTTTTTTTTTGTTAAGTGCCTCACCTTAAATGTACCAAAGTATTTCCAATGTGCTCTATGTTACTTGACAGAACATTATTGGATGCCCATAAAGGAATTTCATTATCATTATGTGATGTAGTAACGGTAATGCAGTATTTATGTTTTGTAAGTGACTATATAAAATATAATTGTCTGCTGTGACCTCAGAAGCAGGATCGGATCGAGGAACTAAAGCGATTGATCGAGAGGCACCGATTTCACATCCGCATGCTGGAAACCATCCTTCGAATGCTGGACAATGACTCGATACAGGTGGACTCCATCCGCAAGATTAAAGATGACGTGGAGTACTACCTTGATTCCTCTCAGGATCCTGACTTTGAGGAGAACGAGTTCCTCTATGATGACCTTGATTTAGAGGAGATAC[G/T]TGAGTGCTTGAAAATGCTTGTCAGAAGGGAGTTTGTTTTTTTTTTTTGGTTCAGTTATAACATTTTTCCCTTCCTGTAGCCCTGCCAGTAGTTCCCACGTCTCCGGCAGGTCACCCAGACGATGAGATCTTCCAGCACTCCAGTTCTACCCCGACCTCCACAACGTCCTCTTCTCCCATTCCTCCCTCTCCGGCAACTTGCACTACGGTGAGCATCTTCTCCTGTAGAGGAATAGGGCTGAACTGTATCGCACCGTATTGGTAGTTTCTTCATATCTATCTTTAATGCATGATATTATCAGCCTCAGTAATGAAATGCACATCCCTAAATCCAGTTTATTCAAATGAGAAATTGAGTGTTTTTTTTTTTTTTGTTTTATGTTCATGTTTACTTCATTTGTGCTGATGAGAATTCGGAAGATGAAAAGAAAAGGGGTCATTCGACAGACAGTGAAATCAGTCAGGTGAGGAGAAAACCCAAATCATTACTCTAAATGTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3043
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 613 906 12 18
ENSDART00000081485 Nonsense 611 846 16 23
ENSDART00000136304 Nonsense 613 908 12 18
ENSDART00000136697 Nonsense 613 885 12 18
Genomic Location (Zv9):
Chromosome 19 (position 10893115)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10351654
GRCz11 19 10270579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCGCCCTCAACAGTGCCAGCCAATCACAGAACAGCCAATCCTCAYCCT[T/G]AAATTTAGCTGTAACAAATCAGCTGTAAGTAATGGCTTGCTCAGAACACC
Long Flanking Sequence:
AATAATTTATTCGTTATGAATTAATTAATTATTCATAAATAATTAATTTACTTCTGCCTATGACGACGATGCCATTGGTCTACATCGCCCAACCCTAATGTGAATACAAACCAGCCAAGAAGGTGGGACAAGGAGGGACAGTCGGACCAGGGTGTGAAAGCACCCTAAAGATTTTAGTTTTTTATCAATATTAATATATATATAATATTTTCAAATAGTTGAGTCTCAAATATTGTTTTATCATAACCAAACATTAATGGAAATCTTCTTTATTCAGTTTTCAGGTAATGTATAAACCTCAGTTAAAAAAAAAAACCACTTATGGTTTTGTGATCCAGGGTCACGTATGATAAAATGACACTAGAGTTTTCATAAATATGTTCACATTTTAATTTAAATATTGCCTTATCTTTCAGGTTATAGTGCTGTGGTAGGAGACAGCACATCAGACTCCGCCCTCAACAGTGCCAGCCAATCACAGAACAGCCAATCCTCATCCT[T/G]AAATTTAGCTGTAACAAATCAGCTGTAAGTAATGGCTTGCTCAGAACACCACAGCAACTTGTTTTTAACTTGTATATTTTCATATTTTATATAAGGATGCACAATATTATCAGAATGTTTAATATGCCAATAATGCTGGTATGTCTTATCAATAAGATGTGTTGATTATTAGCCTGAAACTACTCCAAAACGTGCTTGCTGGGGAGAATTACTTTGATCAAGTAGTTTTCCAGTGTTACATCATCAGACTCTGGCTCAAATTGTTCAAATTTGTTGGTCAAATTTACCATCATTAATTCTTACAACGTGCACAAACTGTACACATTTCAACATATTAAAAACAATAGTGAACTGATTTTTTCTACAGTAAAATTGGGCATTTTAACATGGGAGTCTATGAGGATTACTCCCTGTTGGAGCCAGCCTCCAGTGGCCAGTTGATGAATTGCATTTTCAGTAACTTCTGTATTTGCTTCACACTACTATTAAAAACACTTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29163
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Essential Splice Site 767 906 15 18
ENSDART00000081485 Essential Splice Site 765 846 19 23
ENSDART00000136304 Essential Splice Site 767 908 15 18
ENSDART00000136697 Essential Splice Site 767 885 15 18
Genomic Location (Zv9):
Chromosome 19 (position 10887073)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10345612
GRCz11 19 10264537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTGCTTGGGCACACATGCCTCACCCGTCCGACTCTGAGAGGATCAGG[T/C]GAGCACACACACATACACACACACACAGTTCATTAACATTCACTGATTCT
Long Flanking Sequence:
AATGGGGAAGAAAAGTGATTTAAGTGACTTTAAACTTTGAAGGGGGGTGGGGGGGGGGGGTGGGGGGGGGGTTTACATTTGACATCCAAACCATATGGGTTTAGGATTGTAGTAGAGTTAGTAAAATTAATACTTATTAGTGTTACGGAAATGTTATATTATTGCTCATCCATGTTAGCAACATGACTTTGATTTACTTCAGTTTTTATTATTGAACATGAACATATGTTTAGAGGACTGGTCTGTTATCTTACCCTTTTCTCCACTGTTGGTTGATTTGTCTCCTTCCTCCTCTTCCAGATATATTCCCAAGCTCCACGGCTCCATCAGGCACTCCTGCAGCTCCACAGTTGTCTCTGTCAGAGGTCAGTATCCCTCCATCATTGGGTGTGTGTCCACTGGGCCCCGTTCCGCTCTCCAAAGACCAACTCTACCAGCAAGCCATGCAAGAGTCTGCTTGGGCACACATGCCTCACCCGTCCGACTCTGAGAGGATCAGG[T/C]GAGCACACACACATACACACACACACAGTTCATTAACATTCACTGATTCTGACAGGTGACTACACTCATGTTCCAGGCCTGGGAGATTCTTGGAATCTGGGGAATTTAGTGTTTTACATAAATTTTTCATCATTTTTTTCCACTGGGTTGTATAATATCTAAGGCTGTTTTATGATCATTTAGGGCATTGCAGAATGAGCTGTATCTGCTTATACCATAGCCATAGCACTCAGAATGAAACTAAAAACTACAATAATATTTCATTTGAAATTAGACATCGGATCATAACCGTTTTCAAGCTATACTGTGGTTTGGAAAAGTCAAGGTTTTAAAACCACCATAATGTTCTGCTATACCGTTCCTACAGTATATGTAAGATTTTTTTATTTACGTTTTTGTTTTTAGAGCAACAGTATCTCCAGCAGAAAGCATATCCAAAAATGTTGTTTTAAATTTCATTACAATTATTTAGCCTGACACGTTTACTGCTCCAAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 810 906 16 18
ENSDART00000081485 Nonsense 808 846 20 23
ENSDART00000136304 Nonsense 810 908 16 18
ENSDART00000136697 Nonsense 810 885 16 18
Genomic Location (Zv9):
Chromosome 19 (position 10883197)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10341736
GRCz11 19 10260661
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTTACCAGAGACTGTCTACCGAGACCCTGTTCTTCATCTTTTACTAYT[T/A]AGAGGTGTGTGTGCTWACAATTAATGCCCTCAATGAAGCCTCTGTAATTG
Long Flanking Sequence:
CATTGTGCATATTTATTGCCATATTTAAATAAAATTTCATGTGTCAAATGGTAGCGCGCATTTCAAAATAAAAGTCTGGTATAAGCAAAATAAGTTAAAAATTAAACTTTTGTTATTTTTTGACCACCACTGAAAATGTCCCCGCGACCCAAAAGTGGGTCACCACCAGTTGAGAAACACTGCCTTAGATGAATATATTTGAAGCGATATATTTTGAAGATGTTGGTTCTTCTTACAATACACACAAACGTTATTTCTTTCTATCACTTTTCAGTTGATCCGGGTTGTTTAAATTACAAAATTGTTTTGATTGTGTTTTGTCCAATCCTGTTCAAACACTCAATCTACTTTTTTTTATTTATGCACAAACAGGCAGTACCTAATGAGGAACCCCTGCCCAACACTGCCTTTTCACCACCAGATGCCACCTCCTCACTCCGACAGTGTGGAGTTTTACCAGAGACTGTCTACCGAGACCCTGTTCTTCATCTTTTACTACT[T/A]AGAGGTGTGTGTGCTAACAATTAATGCCCTCAATGAAGCCTCTGTAATTGCAAAAAGGTTGTTTTGTCCATCAGTAAGCACATATGGCTTGCATTTCATTGACTTATCAGAGACACTATTGATCTCTGAGTGAGATTTTAAGGATAACAGTCAGATTATAGTCACTTTTTATTGGTAAACTCTAAGGGACTGACAAATAGTTTTTTTGCACTCCCAAGGGCACAAAAGCGCAGTATCTAGCAGCCAAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTACATGATGTGGTTCCAGAGGCACGAGGAGCCCAAGACCATCACAGATGAGTTTGAACAAGTGAGTAACATTATAAAATGTTCTATGACTAGAGTTTATCATGTATGGTCATTTTATAATTGTTGTTTTAACAATAAGCAATTGCTAGTCACTTAGCAAAAAAACATGGTTTACAATTCCCGGTCCATGTATGCGCAAATCAAACCTGTTTTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 Nonsense 817 906 17 18
ENSDART00000081485 Nonsense 815 846 21 23
ENSDART00000136304 Nonsense 817 908 17 18
ENSDART00000136697 Nonsense 817 885 17 18
Genomic Location (Zv9):
Chromosome 19 (position 10882961)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10341500
GRCz11 19 10260425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGACTGACAAATAGTTTTTTTNNGCACTCCCAAGGGCACAAAAGCGCAGTA[T/A]CTAGCAGYCAAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTA
Long Flanking Sequence:
AATACACACAAACGTTATTTCTTTCTATCACTTTTCAGTTGATCCGGGTTGTTTAAATTACAAAATTGTTTTGATTGTGTTTTGTCCAATCCTGTTCAAACACTCAATCTACTTTTTTTTATTTATGCACAAACAGGCAGTACCTAATGAGGAACCCCTGCCCAACACTGCCTTTTCACCACCAGATGCCACCTCCTCACTCCGACAGTGTGGAGTTTTACCAGAGACTGTCTACCGAGACCCTGTTCTTCATCTTTTACTACTTAGAGGTGTGTGTGCTAACAATTAATGCCCTCAATGAAGCCTCTGTAATTGCAAAAAGGTTGTTTTGTCCATCAGTAAGCACATATGGCTTGCATTTCATTGACTTATCAGAGACACTATTGATCTCTGAGTGAGATTTTAAGGATAACAGTCAGATTATAGTCACTTTTTATTGGTAAACTCTAAGGGACTGACAAATAGTTTTTTTGCACTCCCAAGGGCACAAAAGCGCAGTA[T/A]CTAGCAGCCAAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTACATGATGTGGTTCCAGAGGCACGAGGAGCCCAAGACCATCACAGATGAGTTTGAACAAGTGAGTAACATTATAAAATGTTCTATGACTAGAGTTTATCATGTATGGTCATTTTATAATTGTTGTTTTAACAATAAGCAATTGCTAGTCACTTAGCAAAAAAACATGGTTTACAATTCCCGGTCCATGTATGCGCAAATCAAACCTGTTTTATCCAATATGGGGCAAAATGTTTCATTGGTAGCGTCACTAGCATAATTCGTGGGTAAATATCTTTTTGGCTTTCGTTTATTTTTATAAAAATTAATTTTTCTTTGCGTGGAGATGTTGTAAGTGCAAATTCATAACCATATTTATCATTGTTGTATTTGTTTTAGAGTGTGTTTTGCTGTTATTCTGTAAGTGTTGCCTGATGGCTCGTTTCCACCGAGCGGTACAATTCAGTACAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6547
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 None None 906 None 18
ENSDART00000081485 Missense 835 846 22 23
ENSDART00000136304 None None 908 None 18
ENSDART00000136697 Nonsense 837 885 17 18
Genomic Location (Zv9):
Chromosome 19 (position 10882901)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10341440
GRCz11 19 10260365
KASP Assay ID:
554-4042.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTACATGATGTG[G/A]TTCCAGAGGCACGAGGAGCCCAAGACCATCACAGATGAGTTTGAACAAGT
Long Flanking Sequence:
CAAAATTGTTTTGATTGTGTTTTGTCCAATCCTGTTCAAACACTCAATCTACTTTTTTTTATTTATGCACAAACAGGCAGTACCTAATGAGGAACCCCTGCCCAACACTGCCTTTTCACCACCAGATGCCACCTCCTCACTCCGACAGTGTGGAGTTTTACCAGAGACTGTCTACCGAGACCCTGTTCTTCATCTTTTACTACTTAGAGGTGTGTGTGCTAACAATTAATGCCCTCAATGAAGCCTCTGTAATTGCAAAAAGGTTGTTTTGTCCATCAGTAAGCACATATGGCTTGCATTTCATTGACTTATCAGAGACACTATTGATCTCTGAGTGAGATTTTAAGGATAACAGTCAGATTATAGTCACTTTTTATTGGTAAACTCTAAGGGACTGACAAATAGTTTTTTTGCACTCCCAAGGGCACAAAAGCGCAGTATCTAGCAGCCAAAGCCTTGAAAAAACAGTCATGGAGGTTTCACACAAAGTACATGATGTG[G/A]TTCCAGAGGCACGAGGAGCCCAAGACCATCACAGATGAGTTTGAACAAGTGAGTAACATTATAAAATGTTCTATGACTAGAGTTTATCATGTATGGTCATTTTATAATTGTTGTTTTAACAATAAGCAATTGCTAGTCACTTAGCAAAAAAACATGGTTTACAATTCCCGGTCCATGTATGCGCAAATCAAACCTGTTTTATCCAATATGGGGCAAAATGTTTCATTGGTAGCGTCACTAGCATAATTCGTGGGTAAATATCTTTTTGGCTTTCGTTTATTTTTATAAAAATTAATTTTTCTTTGCGTGGAGATGTTGTAAGTGCAAATTCATAACCATATTTATCATTGTTGTATTTGTTTTAGAGTGTGTTTTGCTGTTATTCTGTAAGTGTTGCCTGATGGCTCGTTTCCACCGAGCGGTACAATTCAGTACAGTATTCATTAATTTCCATTTCTACTGTAAGATATAACAAATTTGCAAACCATACTGTACTGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10327
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027316 None None 906 None 18
ENSDART00000081485 None None 846 23 23
ENSDART00000136304 None None 908 None 18
ENSDART00000136697 Nonsense 882 885 18 18
Genomic Location (Zv9):
Chromosome 19 (position 10878352)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10336891
GRCz11 19 10255816
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCAGAGGAAAAAGGAAGGATTTACGTTTGAGTACAGGYACCTGGAGGAC[C/T]GAGACCTTCAGTGACRGATGGTCAACTAGAAMRGAGAAGGACTACTGWCG
Long Flanking Sequence:
ATTGGTTGTTAATCTATTTATGTTACTTGCTTTGTCGTTTGGATGAATGCCTCAGTAAATCACTCATAAAACTGCAACTTTCCATCAAGCACTGGTAGCTATAGTATCATGTTTATCCATGACAGGCCTAAACAAGCCATATAATTGCACAAAAACACACTCAGCGAAATTTTCTAATAATGATTAATAATAATAATTGTTTAATAATCGTTTAAATCCCTCAAAGAATAAATTATAATTCAGTACTTCCTTGTCTACTTTTTTTGTCCAAGAAACTGTTACTATGATGGTACTAAGCATGTCATCAAAACCAGGCTGACTAATTTCCCAGTGGTTCCCTTGAGATTTTCTGTATATGTGTGATTAAAACCATTTAAAAGGTAACGGAATGGTTTTCTTTTTCTGTCTTTCCGCAGGGGACATATATTTACTTTGACTATGAGAAATGGGGCCAGAGGAAAAAGGAAGGATTTACGTTTGAGTACAGGTACCTGGAGGAC[C/T]GAGACCTTCAGTGACGGATGGTCAACTAGAAAGGAGAAGGACTACTGTCGACATTCCGGACTGAATCAAAACACACACACACACACACACACATGTACACTCTCTTTTATTCATCGCGGAGGAGAGCCAGATGCACATGCGAGGCTGTTTTATGTCTCGCTGGTGCAAAAATGCATCTGGAGCCCCTCCCTTTCTTTACAATCACACCTTCCCATTGGCCACTCCCTTCGTGACTCCGCCCTCTCATTCAGTCAGACTTAACGACAGTACATCGGAAATTTATGGAGCGTTTTTTTTTTTGCGCCAAAGAAGTTGATTGTGGTCAAATAAAGCATTCAGCTCTTTCAATAAGTTGATAGCAAATTGGTGTGAATTATTTAGCTGTGGCTAACATTCTGCCATTATATCAGTAAAATAAAGCCAAACTAATATGATTTTTTTAGCAACAGATGTTTGGTTTAAAGAAAATAAATGATTGGGCACAACTGTTTTTTCTGCTT
Associated Phenotype:
Not determined