Busch Lab

ZMP

nfe2l3

Ensembl ID:
ENSDARG00000019810
ZFIN ID:
ZDB-GENE-040426-2334
Description:
nuclear factor (erythroid-derived 2)-like 3 [Source:RefSeq peptide;Acc:NP_998396]
Human Orthologue:
NFE2L3
Human Description:
nuclear factor (erythroid-derived 2)-like 3 [Source:HGNC Symbol;Acc:7783]
Mouse Orthologue:
Nfe2l3
Mouse Description:
nuclear factor, erythroid derived 2, like 3 Gene [Source:MGI Symbol;Acc:MGI:1339958]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4803
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016135 Nonsense 345 631 4 5
Genomic Location (Zv9):
Chromosome 19 (position 20281506)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18683964
GRCz11 19 18146817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAGGCTGTTTTTGAGCACATTAATATGTTGGATCTATGCAATCTTGGA[C/T]AGATCAACCCTCAGATGCTGGATGACAWGCAAGGCGACATGGACACTCAA
Associated Phenotype:
Not determined