Busch Lab

ZMP

si:ch211-157f15.1

Ensembl ID:
ENSDARG00000019808
ZFIN ID:
ZDB-GENE-030829-19
Description:
envoplakin [Source:RefSeq peptide;Acc:NP_001112369]
Human Orthologues:
EVPL, EVPLL
Human Descriptions:
envoplakin [Source:HGNC Symbol;Acc:3503]
envoplakin-like [Source:HGNC Symbol;Acc:35236]
Mouse Orthologue:
Evpl
Mouse Description:
envoplakin Gene [Source:MGI Symbol;Acc:MGI:107507]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa33854 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18630 Essential Splice Site Available for shipment Available now
sa1564 Essential Splice Site F2 line generated Not yet available
sa33855 Nonsense Mutation detected in F1 DNA Not yet available
sa33856 Nonsense Mutation detected in F1 DNA Not yet available
sa44635 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33857 Nonsense Mutation detected in F1 DNA Not yet available
sa2283 Nonsense F2 line generated Not yet available
sa33858 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33854
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 18 1975 2 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Essential Splice Site 18 1961 2 21
Genomic Location (Zv9):
Chromosome 6 (position 21645011)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17960785
GRCz11 6 23058704
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCACTGATCATCCAAACATCATAAAATTGTTTAACTTTTAAATTTGAC[A/T]GAACACAGGTGAGCAATCTGGCCTTGCTGATTGCACGTATGCAGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18630
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 51 1975 2 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Essential Splice Site 51 1961 2 21
Genomic Location (Zv9):
Chromosome 6 (position 21645113)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17960887
GRCz11 6 23058806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGACACTRTTGAGAAAGATGTACTGCGYGCAGAAGAGCTGCTGCTCCTT[G/A]TAAGAAGCACTTCATTTTTTATAAGCATGATATATTACYAGTACTACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1564
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 144 1975 4 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Essential Splice Site 144 1961 4 21
Genomic Location (Zv9):
Chromosome 6 (position 21645941)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17961715
GRCz11 6 23059634
KASP Assay ID:
554-1507.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAACTTCAACCAAGAATTAACTGGGCTYTGGTACTAAACCAAAAACAG[G/A]TGTGAATACACATTCAATATATTGATTTACTTTTGTATACATTATCAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5363
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 254 1975 7 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Nonsense 240 1961 6 21
Genomic Location (Zv9):
Chromosome 6 (position 21649253)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17965027
GRCz11 6 23062946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAACAGGACTGGAGYGATCAGATGGTCGACCATGCTGACGTTCGCAGA[C/T]AATATGAGGTAAGCTAACTTTTGAAATGATTACATRACATGAAAAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33855
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 611 1975 15 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Nonsense 597 1961 14 21
Genomic Location (Zv9):
Chromosome 6 (position 21659185)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17974959
GRCz11 6 23072878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTAAAAACAAACAGGACAGTCTAGTTGCTCTGAACAGTCTCTACAAA[A/T]AGAAGTATGTAAACTTACAAAAGTGATTATAAAAGGTAATTAAAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33856
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 695 1975 17 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Nonsense 681 1961 16 21
Genomic Location (Zv9):
Chromosome 6 (position 21660032)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17975806
GRCz11 6 23073725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCACTTAAGAAGCTATGCAGTTCACTTCAGCAGGGTTACCAAGAATA[C/A]TGCCCTGATATACGCAGACAGGAAGCAGAAGTGAAGAATCTTCAAAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Essential Splice Site 773 1975 18 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Essential Splice Site 759 1961 17 21
Genomic Location (Zv9):
Chromosome 6 (position 21662179)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17977953
GRCz11 6 23075872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCCAAAGATGATTTGTCTCAAATCCAAGCCAAGCAGAACTCTCAAAAG[G/A]TTAGATTTTTAGACTATCACATAATATATTTCATATGTTAACAAAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 1061 1975 22 22
ENSDART00000130497 None None 630 None 2
ENSDART00000143263 Nonsense 1047 1961 21 21
Genomic Location (Zv9):
Chromosome 6 (position 21663444)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17979218
GRCz11 6 23077137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGCAAAACATAAAAGAGAAGGTGGTGCAAAAGGAAGTGGTTAGACTT[G/T]AAAAAGATCCAGAAATGTTAAAAGCAGTTAGGACATTTGAGTTGGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2283
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 1593 1975 22 22
ENSDART00000130497 Nonsense 330 630 1 2
ENSDART00000143263 Nonsense 1579 1961 21 21
Genomic Location (Zv9):
Chromosome 6 (position 21665040)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17980814
GRCz11 6 23078733
KASP Assay ID:
554-2507.1 (used for ordering genotyping assays)
KASP Sequence:
AACTGAGATCWTTGGAATCTGAAAGACAAAACATCACCATCTCCTTCCAA[C/T]AGCATTCTAGGCTGATGAGTGAAAGAAAYCAAATGAACAGGCAAAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33858
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026448 Nonsense 1741 1975 22 22
ENSDART00000130497 Nonsense 478 630 1 2
ENSDART00000143263 Nonsense 1727 1961 21 21
Genomic Location (Zv9):
Chromosome 6 (position 21665484)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17981258
GRCz11 6 23079177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCATCAAAACTGCACTAAAAGAAGGCAAGGTGACCAAATACCAACTA[C/T]AACAGTATAAGGATGGCAAAATGTCTATTTCAGAGTTTGCTCTTCTTGTA
Associated Phenotype:
Not determined