Busch Lab

ZMP

si:ch211-88n13.3

Ensembl ID:
ENSDARG00000019782
ZFIN ID:
ZDB-GENE-070912-326
Human Orthologue:
IMPG2
Human Description:
interphotoreceptor matrix proteoglycan 2 [Source:HGNC Symbol;Acc:18362]
Mouse Orthologue:
Impg2
Mouse Description:
interphotoreceptor matrix proteoglycan 2 Gene [Source:MGI Symbol;Acc:MGI:3044955]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11343 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27419
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004619 Nonsense 198 784 4 10
ENSDART00000137083 None None 271 None 4

The following transcripts of ENSDARG00000019782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31224397)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30380343
GRCz11 9 30191089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTTGATGAAGAGGTTTTCACTGATGAAGACATACTTCAGATAGACTAT[G/T]AATTCTCAACAATTACAACTGTGGTTGAAGAGAGCCAGATTCTGCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11343
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004619 Essential Splice Site 615 784 None 10
ENSDART00000137083 Essential Splice Site 226 271 None 4

The following transcripts of ENSDARG00000019782 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31222208)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30378154
GRCz11 9 30188900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAACGKTGGCATTTTCCTGAAGTTATTATGTGTGTGTGTCTRCTCTGT[A/C]GATGCCGCGTGGGGGAAAATTGGTGGTACAGAGGAGAGYAKTGTGRAGAA
Associated Phenotype:
Not determined