Busch Lab

ZMP

acp5a

Ensembl ID:
ENSDARG00000019763
ZFIN ID:
ZDB-GENE-040426-2864
Description:
tartrate-resistant acid phosphatase type 5 [Source:RefSeq peptide;Acc:NP_999938]
Human Orthologue:
ACP5
Human Description:
acid phosphatase 5, tartrate resistant [Source:HGNC Symbol;Acc:124]
Mouse Orthologue:
Acp5
Mouse Description:
acid phosphatase 5, tartrate resistant Gene [Source:MGI Symbol;Acc:MGI:87883]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17411 Nonsense Available for shipment Available now
sa40635 Nonsense Mutation detected in F1 DNA Not yet available
sa16094 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Nonsense 20 339 2 6
ENSDART00000135810 Nonsense 20 192 2 5
ENSDART00000142752 Nonsense 37 219 2 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9435482)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8125180
GRCz11 6 8360719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACTAATGCTGGTRTTTTTAAGTGCTCTCCCTGGGGTCCTTTGCTACTA[T/A]TCCTCATTCGTTGACCTGGAAGCTCAAGGAAGTGAGTTGCTATTGATTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5352
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Nonsense 233 339 5 6
ENSDART00000135810 None None 192 None 5
ENSDART00000142752 None None 219 None 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9438847)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8121815
GRCz11 6 8357354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGTGGTCCATATCCGAGCACGGGCCAACTGACTGCCTGCTGAAGAATT[T/A]GAGGCCATTACTAAAGAAGTACAAGGCCACGGCTTACCTTTGTGGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40635
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Nonsense 240 339 5 6
ENSDART00000135810 None None 192 None 5
ENSDART00000142752 None None 219 None 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9438869)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8121793
GRCz11 6 8357332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCCAACTGACTGCCTGCTGAAGAATTTGAGGCCATTACTAAAGAAGTA[C/A]AAGGCCACGGCTTACCTTTGTGGCCATGATCACAACCTACAAGTACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16094
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004716 Essential Splice Site 254 339 None 6
ENSDART00000135810 None None 192 None 5
ENSDART00000142752 None None 219 None 5

The following transcripts of ENSDARG00000019763 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 9438913)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8121749
GRCz11 6 8357288
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGTACAAGGCCAYGGCTTACCTTTGTGGCCATGATCACAACCTACAAG[T/A]ACGTCTCTAAAGGAANCCKCTCTTTTGAAGCGATCTCCGTTAAATMATTT
Associated Phenotype:
Not determined