Busch Lab

ZMP

celsr2l

Ensembl ID:
ENSDARG00000019726
ZFIN ID:
ZDB-GENE-050208-404
Description:
cadherin EGF LAG seven-pass G-type receptor 2 [Source:RefSeq peptide;Acc:NP_001074046]
Human Orthologues:
CELSR1, CELSR2, CELSR3
Human Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologues:
Celsr1, Celsr2, Celsr3
Mouse Descriptions:
cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24043 Nonsense Available for shipment Available now
sa43735 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1933
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082453 Nonsense 78 1478 3 29
ENSDART00000136491 Nonsense 79 1272 3 25
Genomic Location (Zv9):
Chromosome 22 (position 416333)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 403441
GRCz11 22 441164
KASP Assay ID:
554-1921.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTCTCTCTCTCTCTTCATCAGCCGGTGCTGAACCGCGCAGGTCTTCCT[C/T]AGGGGCCGTCGGATCAGAAGGTTGTCGTGGTAACGGTTGACGACTGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24043
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082453 Nonsense 166 1478 4 29
ENSDART00000136491 Nonsense 167 1272 4 25
Genomic Location (Zv9):
Chromosome 22 (position 416671)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 403779
GRCz11 22 441502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGCTGCATGAAGGACCTGCGCATTGACGAGCGGCACGTCGACATGGCC[G/T]GATTCATCGCTAATAACGGAACGCTACCCGGTGAGCTGTCGCTTGCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43735
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082453 Nonsense 365 1478 8 29
ENSDART00000136491 None None 1272 None 25
Genomic Location (Zv9):
Chromosome 22 (position 421462)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 408570
GRCz11 22 446293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGCGTCGGTGGCATCTCGGACGGCAGGAATCGTGTGATTGGTGGATTC[A/T]GAGGATGCATTCAGGTCATTATTACACACACACACACACACACACAGCGT
Associated Phenotype:
Not determined