Busch Lab

ZMP

pbx2

Ensembl ID:
ENSDARG00000019717
ZFIN IDs:
ZDB-GENE-000405-5, ZDB-GENE-000405-5
Description:
pre-B-cell leukemia transcription factor 2 [Source:RefSeq peptide;Acc:NP_571687]
Human Orthologue:
PBX2
Human Description:
pre-B-cell leukemia homeobox 2 [Source:HGNC Symbol;Acc:8633]
Mouse Orthologue:
Pbx2
Mouse Description:
pre B-cell leukemia transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1341793]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28745
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004751 Nonsense 123 403 3 8
ENSDART00000130045 Nonsense 123 420 3 10
Genomic Location (Zv9):
Chromosome 16 (position 51955106)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 48679186
GRCz11 16 48621204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAGGTCTTTCCATGAGAAATGTTCAGGAGGAGGAGCCTCCTGACCCA[C/T]AGCTCGTACGATTGGACAACATGCTGCTGGCTGAAGGTGTAGCCGGGCCA
Associated Phenotype:
Not determined