Busch Lab

ZMP

COLQ (1 of 2)

Ensembl ID:
ENSDARG00000019692
Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase [Source:
Human Orthologue:
COLQ
Human Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase [Source:
Mouse Orthologue:
Colq
Mouse Description:
collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase Gene [So

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa22812 Splice Site, Nonsense Available for shipment Available now
sa36097 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7867
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Essential Splice Site 50 410 3 17
Genomic Location (Zv9):
Chromosome 16 (position 22296496)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20402939
GRCz11 16 20208758
KASP Assay ID:
554-2415.1 (used for ordering genotyping assays)
KASP Sequence:
GAAGGATTCACAGAAGAGAAGCACAATCCTACAACCCACACATGTTCTTC[A/G]GGGCCYCCTGGGCCCCCAGGACCAGCAGGAMCTCCTGGCCCACAGGTATG
Long Flanking Sequence:
ATTATTTCTTTCTTCTTTTGAACACAAAACAAGTGTTGTGGGGATAAAAAGCAACCATTGACGTCCATAGACGGAGCACAAGTCAATAGCTGCTTTTTCCCAGCATTCTTCAATACATCTTCTCTTGTGTTGAAGAAGAACAGAAGAAAGAAACTCAAACATGTTTGGAACAAGAATGCTGAGAGATTTTAAATCTTGGTTTGAACTATCTCTTTAATCTTTAATAGTTTACCATTCAAATGATGACCAAGCAGTTTTATTTTCTGGATAGTCAGGTCAGCTTACTGTGCAGTAATGATGTGATTCCTTGCAGATTGCATTGAAAGCACCTCAACCTGCTCCATCTATGGTATTTACGTCACCCTTTTCCTTTCATTATCAATCAATCAATCAGATGTAATTTTTTATGTCTTGTCTTAGACAAAGACTGAGACTAGTGTTACAGCAAATGAAGGATTCACAGAAGAGAAGCACAATCCTACAACCCACACATGTTCTTC[A/G]GGGCCTCCTGGGCCCCCAGGACCAGCAGGACCTCCTGGCCCACAGGTATGTGCTTCAGATGTGATGTAACTGTTATAGAAGGATTATAGAAACTACGGGCCTAAACTATTAAACCAGATGTAAGATCTATTAGTATGCATTTTAAGCACAATATATTTATAAACGTTTTTTATTTTAGATGATGATAGTGATATAGTGATTTGTGCTTCTGTTTGGATGCTAATTTGTTTATTTAAAACAAGCTAATGTGGAGAGATGGTTTTAAAAAGTGTGTATAAGAGAGAAGATTCTCTTTAAAAACTCTTTATATTTACCAGGGTATATGCAGGAATCCTAAAGGTAATTTCAATACCTTTTTAAGACTTTTTAAAGACCTTTTCGGAATATTTTAAGACCTCGTTATGTGGTGAGTGTCACATCAACTTCCTGCGTTTGTCGCAAATTACGTGACATCACTCTGACGGAGGAGCTTGGCCGGACGCATCCTCGCCCAAACACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22812
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Splice Site, Nonsense 64 410 3 17
Genomic Location (Zv9):
Chromosome 16 (position 22296539)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20402982
GRCz11 16 20208801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTTCAGGGCCTCCTGGGCCCCCAGGACCAGCAGGACCTCCTGGCCCA[C/T]AGGTATGTGCTTCAGATGTGATGTAACTGTTATAGAAGGATTATAGAAAC
Long Flanking Sequence:
ATAAAAAGCAACCATTGACGTCCATAGACGGAGCACAAGTCAATAGCTGCTTTTTCCCAGCATTCTTCAATACATCTTCTCTTGTGTTGAAGAAGAACAGAAGAAAGAAACTCAAACATGTTTGGAACAAGAATGCTGAGAGATTTTAAATCTTGGTTTGAACTATCTCTTTAATCTTTAATAGTTTACCATTCAAATGATGACCAAGCAGTTTTATTTTCTGGATAGTCAGGTCAGCTTACTGTGCAGTAATGATGTGATTCCTTGCAGATTGCATTGAAAGCACCTCAACCTGCTCCATCTATGGTATTTACGTCACCCTTTTCCTTTCATTATCAATCAATCAATCAGATGTAATTTTTTATGTCTTGTCTTAGACAAAGACTGAGACTAGTGTTACAGCAAATGAAGGATTCACAGAAGAGAAGCACAATCCTACAACCCACACATGTTCTTCAGGGCCTCCTGGGCCCCCAGGACCAGCAGGACCTCCTGGCCCA[C/T]AGGTATGTGCTTCAGATGTGATGTAACTGTTATAGAAGGATTATAGAAACTACGGGCCTAAACTATTAAACCAGATGTAAGATCTATTAGTATGCATTTTAAGCACAATATATTTATAAACGTTTTTTATTTTAGATGATGATAGTGATATAGTGATTTGTGCTTCTGTTTGGATGCTAATTTGTTTATTTAAAACAAGCTAATGTGGAGAGATGGTTTTAAAAAGTGTGTATAAGAGAGAAGATTCTCTTTAAAAACTCTTTATATTTACCAGGGTATATGCAGGAATCCTAAAGGTAATTTCAATACCTTTTTAAGACTTTTTAAAGACCTTTTCGGAATATTTTAAGACCTCGTTATGTGGTGAGTGTCACATCAACTTCCTGCGTTTGTCGCAAATTACGTGACATCACTCTGACGGAGGAGCTTGGCCGGACGCATCCTCGCCCAAACACGTGGATTGAGCAAACTGTTAATAATATTAGCAGGAAAATAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36097
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Essential Splice Site 113 410 7 17
Genomic Location (Zv9):
Chromosome 16 (position 22310591)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20417034
GRCz11 16 20222853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAATGTTCTTTAGCTCATAGTGATGTTTGACCTCTGTATATTTTTAAC[A/G]GGGGGAGAAAGGTGACCCGGGATTGATGGGATTGCCAGGGGCTAGAGGAC
Long Flanking Sequence:
TACTCTTAAAGAGATTGTGATGTTGTTTGATGCTAAATTGTTTTTAATTGTTTTAATTACACTTACTGAATGATATTAAAGTAATGTTTACACCATTTCTGCATTTTGAAATCTCGGCAACAGCTGGAGGTTTGTAGTTCAAAGCATGTTACTGCAATGTTTACAGTGCTGGTCCTATACTTCCGGGTTTCTTCCCACCGCAGCCTTGCTTTAGTTCTTCAAAATGGCGGCCACATGAAATAAGCAAATACCAATCGATGATTGGCTCCTCTACCAGAAAGCAGGCTTTATTTGCAATAAAGTGATCGATGATTGGCTCCTGAACTTGTAGGTGGGGCTTTATTCACCATATTGACCGTTACACTTTTCCCCATTCAAAAAGATGCGAGTGTCATGTCTTGTGTATTTAGTTTTTTCTATACATTAGGACACCATATTGTGACACGATCACAGAATGTTCTTTAGCTCATAGTGATGTTTGACCTCTGTATATTTTTAAC[A/G]GGGGGAGAAAGGTGACCCGGGATTGATGGGATTGCCAGGGGCTAGAGGACCAATGGGACCCAAGGTCTAAACAGTCTCTACTTTGTGAATTGGAATTAAAGTTGTAATGCTGTCATAAATGTGTGCTGAATGCTGTTGATTTATGATTGATGCAGGGCTTACATGGATTTAAAGGGGAAAAAGTAAGTTTACCATTCTGAAGCCATTATATTGTCGTTCTTTAGATTGTTTACCTGTTGCTCATCATTGAATTGTTTATTATATCGTGTACATTCAATATTACTTGATGTTGTTGTTTTAGGGTTCACAAGGTTTCAGAGGTGAAATTGGCTTAAAAGGTGACCGAGTAAGTTGTGTTTTAATGCAAATTGTAAGTTGTCTAACATATAATTAGTTTTAGTACACAAATGGCTTGTTCTACCTTTTCAGGGATCAATGGGTCTACCTGGAATGCTGGGACAAAAGGTACTGGAAATATTATTGCATTTTAGTCATTGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2890
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006037 Nonsense 148 410 9 17
Genomic Location (Zv9):
Chromosome 16 (position 22310908)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20417351
GRCz11 16 20223170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTACATTCAATATTACTTGATGTTGTTGTTTTAGGGTTCACAAGGTTTC[A/T]GAGGTGAAATTGGCTTAAAAGGTGACCGAGTAAGTTGTGTTTTAATGCAA
Long Flanking Sequence:
TCCTGAACTTGTAGGTGGGGCTTTATTCACCATATTGACCGTTACACTTTTCCCCATTCAAAAAGATGCGAGTGTCATGTCTTGTGTATTTAGTTTTTTCTATACATTAGGACACCATATTGTGACACGATCACAGAATGTTCTTTAGCTCATAGTGATGTTTGACCTCTGTATATTTTTAACAGGGGGAGAAAGGTGACCCGGGATTGATGGGATTGCCAGGGGCTAGAGGACCAATGGGACCCAAGGTCTAAACAGTCTCTACTTTGTGAATTGGAATTAAAGTTGTAATGCTGTCATAAATGTGTGCTGAATGCTGTTGATTTATGATTGATGCAGGGCTTACATGGATTTAAAGGGGAAAAAGTAAGTTTACCATTCTGAAGCCATTATATTGTCGTTCTTTAGATTGTTTACCTGTTGCTCATCATTGAATTGTTTATTATATCGTGTACATTCAATATTACTTGATGTTGTTGTTTTAGGGTTCACAAGGTTTC[A/T]GAGGTGAAATTGGCTTAAAAGGTGACCGAGTAAGTTGTGTTTTAATGCAAATTGTAAGTTGTCTAACATATAATTAGTTTTAGTACACAAATGGCTTGTTCTACCTTTTCAGGGATCAATGGGTCTACCTGGAATGCTGGGACAAAAGGTACTGGAAATATTATTGCATTTTAGTCATTGACAAGATTAACAAAATGTGCTTTAAAGAGGTTAACTTTATACTGAACAAATTACAGCACAGCAAGCAGGATGTAAAATACAGGGGGCTTTAGGGGGGATTGCCCACCCTAATTAATGTTTGATTCCCCCTGAAGGACATGAAAACAACAAGAGTGGGGGGTCAATCCTCTAAATAGATATAGTTTGCTCTGATCTTAAATACTTATTACTAAATAAATTATAGATAATTTAAATATACATTTGACCACCCCTATAATGGATTATAGCACTATGAATGCATAATTGTTGCGTAAGTATTCACAAAAACGCTTTACTTGTAA
Associated Phenotype:
Not determined