Busch Lab

ZMP

FGL2 (2 of 2)

Ensembl ID:
ENSDARG00000019686
Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Human Orthologue:
FGL2
Human Description:
fibrinogen-like 2 [Source:HGNC Symbol;Acc:3696]
Mouse Orthologue:
Fgl2
Mouse Description:
fibrinogen-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:103266]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38069 Nonsense Mutation detected in F1 DNA Not yet available
sa6131 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38069
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Nonsense 5 434 1 7
Genomic Location (Zv9):
Chromosome 25 (position 21937556)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21169432
GRCz11 25 21267086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCCTAACCCAACAACGATTGTGCAAAAACACCTACAAAACTCAATTG[G/A]TGTGATCCAACAAGCGTGGGTTAAATAAAAATAGTGTAATAATTTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6131
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Essential Splice Site 201 434 6 7
Genomic Location (Zv9):
Chromosome 25 (position 21941031)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21172907
GRCz11 25 21270561
KASP Assay ID:
554-3710.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTCTCAAAATGSAGCTAATGTGCAAGATTTGGATCAGGTTCAACAAGG[T/A]AAAACCCATGTTAGAGACAATAGTGAGGTTGTGTTGATACTTAACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24674
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067277 Nonsense 342 434 7 7
Genomic Location (Zv9):
Chromosome 25 (position 21943192)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21175068
GRCz11 25 21272722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATAGATGGTTACTCTGGTACAGCTGGCAATGCCATGCAATTTAGCAAA[A/T]AGTACAACCATGACCAGAAGTTCTTCACCACTCCGGACAGAGACAATGAC
Associated Phenotype:
Not determined