Busch Lab

ZMP

si:ch73-111a8.1

Ensembl ID:
ENSDARG00000019658
ZFIN ID:
ZDB-GENE-050411-38
Human Orthologue:
POU2F2
Human Description:
POU class 2 homeobox 2 [Source:HGNC Symbol;Acc:9213]
Mouse Orthologue:
Pou2f2
Mouse Description:
POU domain, class 2, transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:101897]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36053 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10161 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36053
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049323 Essential Splice Site 123 695 6 17
ENSDART00000141032 None None 485 None 15
Genomic Location (Zv9):
Chromosome 16 (position 12678604)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11083847
GRCz11 16 10974749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCATATTTTTCCTCTCTGCTGCTCTTTTTCTCTCTCTATCTCTCTCTA[G/A]TTGACTGCACTTTTGCCTGCACAGCAGCAGCTGCTCTTACAGCAGGCGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3969
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049323 Nonsense 243 695 7 17
ENSDART00000141032 Nonsense 144 485 6 15
Genomic Location (Zv9):
Chromosome 16 (position 12680733)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11085976
GRCz11 16 10976878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTCGTTCCAGGACACACTCTGCCTTCACCCGCACAGTTTCTCTTACCA[C/T]AAACACAGCAAGGCCAGCAAGGTACAGCTCAATTTCTATTTGTACTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10161
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049323 Essential Splice Site 423 695 11 17
ENSDART00000141032 Essential Splice Site 324 485 10 15
Genomic Location (Zv9):
Chromosome 16 (position 12683937)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11089180
GRCz11 16 10980082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGCATTGAGACCAATGTCCGCGTCRCTCTGGAACACAGCTTTTTAGCG[G/A]TCAGAACATATGATTTCATAACCAATACAAACTYTACACAACYATATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2887
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049323 Nonsense 456 695 12 17
ENSDART00000141032 Nonsense 357 485 11 15
Genomic Location (Zv9):
Chromosome 16 (position 12686295)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11091538
GRCz11 16 10982440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACATGGAGAAGGAGGTGATCCGCGTGTGGTTCTGCAACCGCCGACAG[A/T]AAGAGAAACGTATTAATCCCTCCAGTGCCACCCCTCCCTTGCCCAGCCAA
Associated Phenotype:
Not determined