Busch Lab

ZMP

rims2

Ensembl ID:
ENSDARG00000019622
ZFIN IDs:
ZDB-GENE-040426-1656, ZDB-GENE-040426-1656
Description:
Regulating synaptic membrane exocytosis 2 [Source:UniProtKB/TrEMBL;Acc:Q6PC83]
Human Orthologue:
RIMS2
Human Description:
regulating synaptic membrane exocytosis 2 [Source:HGNC Symbol;Acc:17283]
Mouse Orthologue:
Rims2
Mouse Description:
regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14738 Nonsense Available for shipment Available now
sa36242 Nonsense Mutation detected in F1 DNA Not yet available
sa22936 Nonsense Available for shipment Available now
sa22935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 237 1473 4 28
Genomic Location (Zv9):
Chromosome 16 (position 47344082)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44525723
GRCz11 16 44512901
KASP Assay ID:
2261-0247.1 (used for ordering genotyping assays)
KASP Sequence:
CCAAACCAAAAATACRACCAAAGGGAGGAGAAGGCGGWTCGTTCGCAGTA[T/A]GCACCAGGAGAGGGCGGCATGCCACGATCGCCGTCTGACTATGGAGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36242
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 327 1473 4 28
Genomic Location (Zv9):
Chromosome 16 (position 47343814)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44525991
GRCz11 16 44512633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGCAGGAGGAGTACCAGAACCGCTACCGCAGTGACCCAAACCTGGCT[C/T]GATACCCTGTCAAACCACAGCCCTACGAGGAGCAGATGCGCATGCACGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22936
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 986 1473 18 28
Genomic Location (Zv9):
Chromosome 16 (position 47268276)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44466976
GRCz11 16 44431331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTTCAGACCAGCCCCACAGGGACCCCCATAAACAGCCGGAGAGGAAGA[C/T]AGCTGCCACAACTGCCTCCAAAGGGGACGCTGGAGAGAAGTATGTTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22935
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016817 None None 286 None 6
ENSDART00000079296 Nonsense 1214 1473 23 28
Genomic Location (Zv9):
Chromosome 16 (position 47215411)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44414201
GRCz11 16 44379125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCCGTAAGCCTGGTGGGAACGGACGACAAGAAACGGCGCTCCAGCATC[G/T]GAGCTAAGATGGCGGCAGTGGTGGGATTGAGCCGAAAGAGTCGCAGCGCT
Associated Phenotype:
Not determined