Busch Lab

ZMP

asap2b

Ensembl ID:
ENSDARG00000019564
ZFIN ID:
ZDB-GENE-030131-5060
Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2b [Source:RefSeq peptide;Acc:NP_001038398]
Human Orthologue:
ASAP2
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:2721]
Mouse Orthologue:
6530401G17Rik
Mouse Description:
RIKEN cDNA 6530401G17 gene Gene [Source:MGI Symbol;Acc:MGI:1923478]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa37060 Nonsense Mutation detected in F1 DNA Not yet available
sa3052 Essential Splice Site F2 line generated Not yet available
sa37061 Essential Splice Site Available for shipment Available now
sa14060 Nonsense Available for shipment Available now
sa45704 Nonsense Mutation detected in F1 DNA Not yet available
sa14030 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29383
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Essential Splice Site 42 1024 1 28
Genomic Location (Zv9):
Chromosome 20 (position 29660927)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29732140
GRCz11 20 29635019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCACGCGCATGGCTCACTGCAGGAATACAGTCGCCGCTCTGGAAGAGG[T/C]AAAACACAGTCAACAATACAAGTATAGCACAATTCAAGACTAACGCCAAG
Long Flanking Sequence:
TGATTGGGCAGAAAGACAGTATGGTCCTTTCTAATTGGCGAACTGTATGTGATTGACAGGTAATTGACTCCACCTACAAAATCCCATGTAAAGTGAACTTGTACAGTACAGGTAGGACGGGCGGAATCCAGAAGTGTTGATCTTGTCAGCTGCTCGTGTGATGGAGTTGTTTAACGCTTGTGTTCAAAGGCAAATCCTCTCCTCATCGGCCGTTTACATTTTAACTTCACGCGGAAATTTAAAACTGAACTAATCTCTAAGGAATGACTGAAATGGACTTGAGTTGAAGTCTGGTTTTTGAGCGCGAAGCTACAACTTTAAGCAAACTTTCTTTCTTTTTTGGATCTATTGTGTAGATTTAAAAGGAATAATCATGCCTGATCAGCTGACAGTGACTGAGTTTGTGGATATTACCCATGAGGACTATAAAGCACCGACAACATCAGTGTTCTGCACGCGCATGGCTCACTGCAGGAATACAGTCGCCGCTCTGGAAGAGG[T/C]AAAACACAGTCAACAATACAAGTATAGCACAATTCAAGACTAACGCCAAGTGTAAAGGGCACAGTTCACATCTCCATTTGTGACTATATCTATGTATATGGTCTTTTTAACCAAAGCAGCTGGAAAATGACTTCCTTCTAGCCAGAAAACTCAGTGTATCCACCAGGGCTGGAAGTGAACCTCGCCCATGTTCAGCTGCTTATTCTTATCGCAGTGTTATGAAATAAATAGACTAGCCTCTGACGCCTCTGTCTGGTCATTAAGTTTTTTCTAAAGCTTTTAAAGTCAGTCAGAGTGATAATGTGTACTTATAATGATCACATACACTTACTATAACATTATTATTGAATAATAACACTGGTATTAATTAATACAGCGTTATGGATGTGACATTTGCTGTAAAAACTCAATACATACATTTACAGGGAGAGTATATGCTAACATTATATTGAAACATCTGTTTATATTTTCCAAAACTACTAACCACGGAGTTATGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Nonsense 352 1024 12 28
Genomic Location (Zv9):
Chromosome 20 (position 29685938)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29757151
GRCz11 20 29660030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCTGTTTCCCTTGCAGCCCAATGCACCGCCAGCAAACCTGAACCTCT[T/G]AACCTGCCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCA
Long Flanking Sequence:
ACAGTTACTAAGTCCATTAGGTTTATGTGATGAAGGCTTTTCTCCACATTACAGACTGAGGAAAGTTTGGCAGAAAAGGAAGTGCTCTGTGAAAAATGGATTGTTGACTATTTCACATGGAACGGTAGGAGAACAAAGCAACACTCTAACTTTGTAATTCATGTTTGTTAATTTATACAAGCTAATACCTGCACCATTTTCACAACATACTGAATGTTAAGGACAATGATGTATTTGTGTCAACATAATCTCAAAATATCATGTCATGATTTGGGAAAATAAGAATGTTAAATTGTTAAATATTAAAACATGTTTTGTTTTCAGCTAATGTTTATATTATTTTATGTAACAAAAACATTGAGTTACTATTATTTATGTATATTAACCCTGATTTATGGATAATAATTCTATAAATGCCATCAGTTTTCCTTGTTCTCTCCTAATGTATCCGTCTCTGTTTCCCTTGCAGCCCAATGCACCGCCAGCAAACCTGAACCTCT[T/G]AACCTGCCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCACGTAATGTAGTTTTACAATCACAGCACAAAACTGACATAAATTCACAGCCAGTATCATCAGAGTCTGTCAAGGCTCATATGGCTGATTGATCCCCTCACGTTTCTCCTCCATCTTCTAGATGACAGAACGTATCACTTCCAGACTGAGGATGAGGCAGAGTGTCAGGTGTAAGTATGTGCACATAGCGAGTGTGCAATTTCACATGAAATTTACTTGAACATATTAAGAGACTGCTTAAATTCTCAGTTTTTCTGGCTTTAGTGAATTTATTAGATATGGCTTTGGAAATTATTTTAATTTTTATTTTCTACTTTACAGTTCAGATTGAATTTAAAACTGAATTTAAATTAAAATAGTCATTTATAGCCTTTTTTTTCAAAAACTGACAGTCAGAATAACAAGGCTGCATCCAAATATTGCTACTAGATTTGAATTTACTTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3052
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Essential Splice Site 370 1024 12 28
Genomic Location (Zv9):
Chromosome 20 (position 29685995)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29757208
GRCz11 20 29660087
KASP Assay ID:
554-2583.1 (used for ordering genotyping assays)
KASP Sequence:
CCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCAC[G/A]TAATGTAGTTTTACAATCACAGCACAAAACTGWCATAAATTCACAGCCAG
Long Flanking Sequence:
GAGGAAAGTTTGGCAGAAAAGGAAGTGCTCTGTGAAAAATGGATTGTTGACTATTTCACATGGAACGGTAGGAGAACAAAGCAACACTCTAACTTTGTAATTCATGTTTGTTAATTTATACAAGCTAATACCTGCACCATTTTCACAACATACTGAATGTTAAGGACAATGATGTATTTGTGTCAACATAATCTCAAAATATCATGTCATGATTTGGGAAAATAAGAATGTTAAATTGTTAAATATTAAAACATGTTTTGTTTTCAGCTAATGTTTATATTATTTTATGTAACAAAAACATTGAGTTACTATTATTTATGTATATTAACCCTGATTTATGGATAATAATTCTATAAATGCCATCAGTTTTCCTTGTTCTCTCCTAATGTATCCGTCTCTGTTTCCCTTGCAGCCCAATGCACCGCCAGCAAACCTGAACCTCTTAACCTGCCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCAC[G/A]TAATGTAGTTTTACAATCACAGCACAAAACTGACATAAATTCACAGCCAGTATCATCAGAGTCTGTCAAGGCTCATATGGCTGATTGATCCCCTCACGTTTCTCCTCCATCTTCTAGATGACAGAACGTATCACTTCCAGACTGAGGATGAGGCAGAGTGTCAGGTGTAAGTATGTGCACATAGCGAGTGTGCAATTTCACATGAAATTTACTTGAACATATTAAGAGACTGCTTAAATTCTCAGTTTTTCTGGCTTTAGTGAATTTATTAGATATGGCTTTGGAAATTATTTTAATTTTTATTTTCTACTTTACAGTTCAGATTGAATTTAAAACTGAATTTAAATTAAAATAGTCATTTATAGCCTTTTTTTTCAAAAACTGACAGTCAGAATAACAAGGCTGCATCCAAATATTGCTACTAGATTTGAATTTACTTCACGGCTGTTAGAAAAGCAGGTTCTATATAGTTTAAATGTGAGTTATGTGAATGGAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Essential Splice Site 371 1024 12 28
Genomic Location (Zv9):
Chromosome 20 (position 29685996)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29757209
GRCz11 20 29660088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCACG[T/C]AATGTAGTTTTACAATCACAGCACAAAACTGACATAAATTCACAGCCAGT
Long Flanking Sequence:
AGGAAAGTTTGGCAGAAAAGGAAGTGCTCTGTGAAAAATGGATTGTTGACTATTTCACATGGAACGGTAGGAGAACAAAGCAACACTCTAACTTTGTAATTCATGTTTGTTAATTTATACAAGCTAATACCTGCACCATTTTCACAACATACTGAATGTTAAGGACAATGATGTATTTGTGTCAACATAATCTCAAAATATCATGTCATGATTTGGGAAAATAAGAATGTTAAATTGTTAAATATTAAAACATGTTTTGTTTTCAGCTAATGTTTATATTATTTTATGTAACAAAAACATTGAGTTACTATTATTTATGTATATTAACCCTGATTTATGGATAATAATTCTATAAATGCCATCAGTTTTCCTTGTTCTCTCCTAATGTATCCGTCTCTGTTTCCCTTGCAGCCCAATGCACCGCCAGCAAACCTGAACCTCTTAACCTGCCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCACG[T/C]AATGTAGTTTTACAATCACAGCACAAAACTGACATAAATTCACAGCCAGTATCATCAGAGTCTGTCAAGGCTCATATGGCTGATTGATCCCCTCACGTTTCTCCTCCATCTTCTAGATGACAGAACGTATCACTTCCAGACTGAGGATGAGGCAGAGTGTCAGGTGTAAGTATGTGCACATAGCGAGTGTGCAATTTCACATGAAATTTACTTGAACATATTAAGAGACTGCTTAAATTCTCAGTTTTTCTGGCTTTAGTGAATTTATTAGATATGGCTTTGGAAATTATTTTAATTTTTATTTTCTACTTTACAGTTCAGATTGAATTTAAAACTGAATTTAAATTAAAATAGTCATTTATAGCCTTTTTTTTCAAAAACTGACAGTCAGAATAACAAGGCTGCATCCAAATATTGCTACTAGATTTGAATTTACTTCACGGCTGTTAGAAAAGCAGGTTCTATATAGTTTAAATGTGAGTTATGTGAATGGAATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14060
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Nonsense 385 1024 13 28
Genomic Location (Zv9):
Chromosome 20 (position 29686156)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29757369
GRCz11 20 29660248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCTAGATGACAGAACGTATCACTTCCAGACTGAGGATGAGGCAGAGTG[T/A]CAGGTGTAAGTAWGTGCACATAKCRAGTGTGCMATTTCACATGAAATTTA
Long Flanking Sequence:
AAGGACAATGATGTATTTGTGTCAACATAATCTCAAAATATCATGTCATGATTTGGGAAAATAAGAATGTTAAATTGTTAAATATTAAAACATGTTTTGTTTTCAGCTAATGTTTATATTATTTTATGTAACAAAAACATTGAGTTACTATTATTTATGTATATTAACCCTGATTTATGGATAATAATTCTATAAATGCCATCAGTTTTCCTTGTTCTCTCCTAATGTATCCGTCTCTGTTTCCCTTGCAGCCCAATGCACCGCCAGCAAACCTGAACCTCTTAACCTGCCAAGTGAAGCGTAACCCAGATGAGAAAAAATGCTTTGATCTCATATCACGTAATGTAGTTTTACAATCACAGCACAAAACTGACATAAATTCACAGCCAGTATCATCAGAGTCTGTCAAGGCTCATATGGCTGATTGATCCCCTCACGTTTCTCCTCCATCTTCTAGATGACAGAACGTATCACTTCCAGACTGAGGATGAGGCAGAGTG[T/A]CAGGTGTAAGTATGTGCACATAGCGAGTGTGCAATTTCACATGAAATTTACTTGAACATATTAAGAGACTGCTTAAATTCTCAGTTTTTCTGGCTTTAGTGAATTTATTAGATATGGCTTTGGAAATTATTTTAATTTTTATTTTCTACTTTACAGTTCAGATTGAATTTAAAACTGAATTTAAATTAAAATAGTCATTTATAGCCTTTTTTTTCAAAAACTGACAGTCAGAATAACAAGGCTGCATCCAAATATTGCTACTAGATTTGAATTTACTTCACGGCTGTTAGAAAAGCAGGTTCTATATAGTTTAAATGTGAGTTATGTGAATGGAATTCAGACGTACTACAACTGCCATTTGTCATTATCACATGATCTACCCTCGTCAGTTGCGTTGCTTCTGTCCCATTTATGAATTCTCTCACATGGCATCATGGGATAGCGGAGTGCCCATTGGATGCACACTTCAGAATCTCACCGGAAGTAGTAAGCCATCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Nonsense 472 1024 15 28
Genomic Location (Zv9):
Chromosome 20 (position 29688992)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29760205
GRCz11 20 29663084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGCATTGAATGCTCTGGGATCCATCGGGAAATGGGCGTCCACTACTCC[C/T]GAATACAGTCTCTGACACTGGACCTCTTAGGCACATCTGAACTATTGGTA
Long Flanking Sequence:
AAAAGAAAAATAACTATAAATTAGGCAAATAAAATAAAAATAAAAAGATTAAATTAAATTATAAATTTATTTGTTACCAAAGTGCATCTTTAAACATTTCTACAACAAAATATTATTGTTAAATGAAATCACCGAATTTTTGTTGTTGTTTTTTTTTTTCCTGCTTGATGTGCACAAACTAAAATAAATATTTTAGGAGAGTGATTATTGCCCCAACTCGCACTGCTTTTTTCATATCAAATCAACACCCTGTGCTTCCTGTTTTGCATCTGGTCTTTTGGCTGGTCTTTGTGCATTGTAGTAAACTTAGTCATCCCAGTAGAACTTGTTTGTATAGTTATTCAGATAGAAAAAGATAACCCTGGATGAAATTCAAATAAAACATCAGTGGCTTTTCTCTGTTGTTGTCTACAGATCCAACATGGCTCTCCACAAACCTGGGTGTGTTGATTTGCATTGAATGCTCTGGGATCCATCGGGAAATGGGCGTCCACTACTCC[C/T]GAATACAGTCTCTGACACTGGACCTCTTAGGCACATCTGAACTATTGGTAATATGGTAACATTCTTTCTTTCCTTTTTAGGCAGGAATTTTATATATTTTATATATAACATTACTGAATGCTTTGCAGCTTGCTAACAGTGTGGGAAATGCAGCATTCAATGAAATCATGGAAGCAAAACTGTCTTCAGAGATCCCAAAACCCAACCCTTCTAGTGACATGTAAGCAACACATCTGTTGTTATCTTTAGTAATCTTTAGTCCTATATTTGTATTTTATGTTTTAAACTGCCGTGCAAAATATATTTAGAGTATCTACATAACCAGCCAGTGTTTAAAAATATCTCTTTACATTAGTCTGATGTACAGTGGTAAGTTTGTAATGATGTTTTACAACTTTAGTGGAGCCGGTAGGTTTTTACGTATACAAGTGTAATAAAATTAGCTGCCATTCATCTTCGCATTTTCAGTAGGACTCCCAGTTAAGGATCGGTTATAGCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29384
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Essential Splice Site 648 1024 19 28
Genomic Location (Zv9):
Chromosome 20 (position 29692432)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29763645
GRCz11 20 29666524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGAATGTATGAAGCTGCTGCTGCGGGGGAAAGCATCTGTCAGCATTA[G/A]TAAGAGATACAATATAACTTCCTGCTTTCACATCAGGCATTAAAAGTATA
Long Flanking Sequence:
CCAAATATTTGAATCCCTTGTCCAAAGAGCACTGACACATTACCTATCCCTGAAGCACTTTTTGGTTTGATTTTGGCTGTATTCATGTCTTTTAGGCGGTTCATTCTGCTGTGGCAACCCCCGATTAATAAAGGGACTGACCTAAAAAAACGAAAATGAATGAATGATAACTGTCTTTTACTGACAGGAACCAGGCGAGACATCACTACATCTTGCGGTACGAATGGTGGACCGAAACTCCCTCCATATTGTGGACTTTCTTGTACAGAACAGGTGCTCCACTGATCTTCTGTATCGCTGCTAAATAATAAATCCTGTTGAATAAATAAACCTTGAATTTTGCATGCATGTCCAATATTTGTGTGCATGTGTTTGTCTGTGCAGTGGCAATTTAGACAAGCAGACAGCCAAAGGAAGCACAGCGCTACATTATTGCTGCTTGACTGATAACAGTGAATGTATGAAGCTGCTGCTGCGGGGGAAAGCATCTGTCAGCATTA[G/A]TAAGAGATACAATATAACTTCCTGCTTTCACATCAGGCATTAAAAGTATATGATATGATACTTTAATATAATTAAATATGTTTAAAATGCAAAATAAATGACAAGAATACAGACTGGAAAATATTCTGGATTTAATGAATTTAGTATGGTTTGAATACAATGTTATTCAATAAAAGGTCTGATAACATTTCTTCCAATTATTAAATAAAAATATTACAATTTAAAGCATATTTTTATTATCAGAAATATCATTTAATGTCAGAAAAACAAATGCATTTATTTGTTGTTATTAAAAATATATATATACTATTTTAACAAATATTAGTTTCTTACCTTTTCTGAAGTAAAGATATTGGTATTGTGTTGTCAGAAATCAATATAAACATTTCAGAGATTTTTTATTTGGTTGAAAAGTCATTAGTATAAAACTATAAATTGTGGCATCTTAATTTTGTCCATAGCTGTACTTTTAATACTTTTACTTTCAGTTCTTTTACCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29385
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Essential Splice Site 707 1024 21 28
Genomic Location (Zv9):
Chromosome 20 (position 29693339)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29764552
GRCz11 20 29667431
KASP Assay ID:
2261-4478.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCATAATGAGGATCTGGACGAGAGCGAAGATGAGATGGAGGACAAGG[T/A]GTTTACTTGCATACTCAACATATTAAATTTTATTAAATTACATTTATTAA
Long Flanking Sequence:
TTGAAAAGTCATTAGTATAAAACTATAAATTGTGGCATCTTAATTTTGTCCATAGCTGTACTTTTAATACTTTTACTTTCAGTTCTTTTACCACTTTTTAAAACTAAACTAAGCAAAAGTGTAAGCTATTTATTGTTTTAAAAAAATGAAATATTTTTTCATTAAACAAAAAGTGTAATAATAATAATAATGAAATAAATGTTTTTCTTGCAGCTAATGATGCTGGAGAGACTGCTCTGGATTTGGCGCAGCGTCTCAAACACTCCAAATGCGAGGAGCTGGTGGGTATATTTTCTTGAGCGCAGTTTTTAAACTGTGCTGCTTTTTGCTGTTATTTTCTTTGAGAGCAAATACCCATTGAGTGTGTTACTGTATGCTGTGTGATTGACAGCTGACTCAGGCGCAGACGGGGAAGTTCAATGTCCATGTGCATGTGGAATATGACTGGCGTCTGCATAATGAGGATCTGGACGAGAGCGAAGATGAGATGGAGGACAAGG[T/A]GTTTACTTGCATACTCAACATATTAAATTTTATTAAATTACATTTATTAAGTATACATTAAATTGAACAAAAGTAACAGTGAAGATATTGTTACAAAAGATTTGTAATTTAAAAATAAATACTGCATTTCAATTGTTTTATAACAAAATTATAACAATAATATTTTGCAGCATGATTGACATCATTTAATAATGATATATATTTATTTACACATTTTTTGAGCTGTAAATCAAGTAAAATGAAAATTATGTAAAGCATATTAGAAAGATTTCTGAAAGATTATGTGAAACTAAAGACTGGAGGATTGGAAAAGGTTTTAAAATATATTAAAACAAAATATTTCATTAAAATAGTGTTTGCAGTACTATTTCACTGTAGGAATCATTATATAGTAAAATTAATGTACAGTTGAAGTCAAAATTTGCCCTCCTGTGAAGTGTTTATTTTCTTACAAATATTTCCCAAGTGCTGCTTAACACAGAGCTTTTTGTAACACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101556 Nonsense 815 1024 23 28
Genomic Location (Zv9):
Chromosome 20 (position 29695155)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29766368
GRCz11 20 29669247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGGTAGACARAGGTCATGTTCAGAWCCTGCAAACCCTCAAACTCCTGAA[C/T]AAAATAACTCTGTGTATGGTGAGTCTGACCTCCTGACAGCGACTTGATTT
Long Flanking Sequence:
GCGCTCTGGCTCGGGACGTGGCCAATGTGGTCAATAATAAGCAGAGGGCTTTTATTCCGAGCATGATGATGAACGAGACTTACGGCACCATGCTCGATCCCAACTCTCCACCACTGGGTTTACCAGGAGTACCTGGCATTCCTCTTTTACCCCCTCGGCCCTTGGGAAGGGGTGAGTAGCAGTCAGTCCGAGGAGCTTTAAATAGATAGTTCAACAAAAAATCAAGCTTTGCTGTTAATTTACTCACCCTAGGGTCATCCGATATATAGATAACAATTTTCTGCAGTAGAACTTTAAGAAGATTTTTAGCTAAATCTGTTGTCCTTGGTGTGATTTATACAAAGCAACTGCTTGGGCTTTAAGATGTAGGATGTACAGCAAATGTCTGTTAATGCACCTGGACTTACCCTGTGTGTGTGATGTCAGGATGGAGTCCACCAATGGAGAACATCGGTAGACAGAGGTCATGTTCAGATCCTGCAAACCCTCAAACTCCTGAA[C/T]AAAATAACTCTGTGTATGGTGAGTCTGACCTCCTGACAGCGACTTGATTTCATTATAAATAATCATATAAAGTGCTGGGTAGTTACTGATTTTACTGTATAATATGCAACTGAACAACTATTAGCCCTTTTGTGAATTTTCTTTTTTAAACATTTCCCAAACAATGATTAACAGAGCAAAGGATTTTTCACAGTATTTCCTAAAAATTTTTTCTTCTGGAAAAAGTCTTATTTATTTTATTTGGGCTACAATAAAAGCAGTTTTTAGAAACATTTTAAGGTCAAAATTGTTAGCCCCTTTAAGCTATATATTTTTTTTAGATTGTCTACAGAACAAACTGTTATACAATCACTTGCCTAATTTAGCTAATTAACCTGATTAAGCCTTTAAATGTCACGTTAAATACTAGTATATGGTAAAAAATTATTTTAATAATTCTGACTTCAATTTTATATAGAAAGTTACAAATTAGCAAAATTATTTGAATTAGAAAATGCTTA
Associated Phenotype:
Not determined