Busch Lab

ZMP

si:ch211-168m18.1

Ensembl ID:
ENSDARG00000019549
ZFIN ID:
ZDB-GENE-070705-78
Description:
Phosphatidate cytidylyltransferase [Source:UniProtKB/TrEMBL;Acc:A5PN44]
Human Orthologue:
CDS1
Human Description:
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 [Source:HGNC Symbol;Acc:1800]
Mouse Orthologue:
Cds1
Mouse Description:
CDP-diacylglycerol synthase 1 Gene [Source:MGI Symbol;Acc:MGI:1921846]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40520 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26536
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017451 Essential Splice Site 209 431 7 12
Genomic Location (Zv9):
Chromosome 5 (position 41639487)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39414204
GRCz11 5 40014357
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCCTACAATACGTGTTTGTAAAATAAAATTGTTTTTTGTTCTCTAA[G/T]GTTTATTGTTCCCATCTCTATTGTGATCTGCAATGACATCATGGCCTACC
Long Flanking Sequence:
AGAACTTTGTCAAAACTGTCCATGTGCCATCAGTGGTTCAACCTTTATTTAATAAAGCTATTAGAATAGAACAAAATGTCCATGTTTGAAGATTTCAACAGTTTGAATTGCAGTGTGACAAACAGTGCTTCCATCAAACTGCTGCATAAGAGTAGAAATTATTGAATAAAGTCATTATTTTTGTCCACACAAAAGTATTCTTGTATCTTCATTATATTATGAATTAACCACTGATAACACATGGACTGTTCTGATAATATTTTTGCTACCTTTCCCAATGTTTCATGAACCTTGCTGACATATAGGGTAACCAAGGACTAGGATTTCATCACAAATCTTTGAATTTGTTACGGAGATCAAACTAGTTAAAAGTAAAGAAAGTAATTAAAGAGATTTTATTTTTGAGTGGACTCTCTCATTAATGCATCACTGATTACTGCACAGTTTTCCTCTGTCCTACAATACGTGTTTGTAAAATAAAATTGTTTTTTGTTCTCTAA[G/T]GTTTATTGTTCCCATCTCTATTGTGATCTGCAATGACATCATGGCCTACCTGTTTGGCTTCTTTTTTGGAAGAACTCCACTGATTAAGGTAAACTTGTGAAACGTACATGGTAGATGTTTCATCTCATAATAATTAAACATTTGTTTTCTTTTATTATTTAATGCACAGTTATTCAGTTAATCCACGTATATTTTTTTTTTTTAGAAAAATTGCTTCTTTTCTCAAACCTCTTCGATTTCTTGCAGCTCTCCCCAAAGAAGACCTGGGAAGGATTTATTGGGGGATTCTTTGCAACAGTGGTCTTAAGTTTTTTTGTAAGTCATCAATAGATCTTTAGGCAACACCATATGCTAGATTTATGCAATTTTGTATGAGATTACAGTGCTATAAAAGTGGCAGTGGAAAATTCTGTGGATGTTTCTACAGAGAATCCTCAAGTTTTAAACACTGATGCTACCAGCTCATTTACATCTACTAAGTGCAGTGTTAAGTAGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40520
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017451 Essential Splice Site 387 431 11 12
Genomic Location (Zv9):
Chromosome 5 (position 41635750)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39410467
GRCz11 5 40010620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATCTGATGGCGACATTCGTTCATGTTTACATAACAAGTTTTATCAGG[T/A]GAGAAAATCAGGTTACTCTTAACATCAGCCATCCAAATACATCAAATAAA
Long Flanking Sequence:
TGACAATAAATTAGCCTTGGCAGTTTGATGAGGTGTGAGGGACTCAACATTTGGTGCTGTTTTCGCTGTCAGGGATTGTTTCATTCCTCAAACATTTGAAAAGATCCTAATTTTCTAACAGTGATGCTTCTTTATAATATACTGGCAGCTCATGTCTGTGCCTTTCTTCTGTCTGCAGAAAACGGTGAACCTTTACCCGTTTCAGATCCACAGTATTGCGCTCTCTTCATTCGCCTCTCTGATCGGGCCATTTGGTGGATTCTTTGCCAGCGGCTTCAAACGAGCTTTCAAGATCAAAGTTAGTTCCCGTTCAGCAGAAATGTGTATCAGTTTCATGCAGACTTTACCTGTGTGGAGTGACAGTTACACTGTAAGCTTGTGTTTTGATTCTGTAGGACTTTGCAGACACCATTCCTGGTCATGGTGGAATAATGGATCGGTTTGACTGTCAGTATCTGATGGCGACATTCGTTCATGTTTACATAACAAGTTTTATCAGG[T/A]GAGAAAATCAGGTTACTCTTAACATCAGCCATCCAAATACATCAAATAAATGGATCTGCTCGTCACACACACACACACACACACAACAGCTGTTTGACCTTCAGAAAGCTGCATTTAGTATAATAACTCTGATTGTCGATCACAACAGATAAAAACATTTGATATTTTGAGCAATTATACAGAGGATTTCTTGACAGAAAAAAATGCTCTGATAATATATTTTTAAATATGGAAATGTTATTTGGCATATTTCTAAATGATTTTATACTTTAATTGTGTTTTTTTTTTTTACGATGTGTTCAATTAGTTTAAAGGTTTTTATTGCAATGTGAGATGAAGAAATGTTCATAATATGTAAAAAAAAAAAAAAAAAAGCTCATAAGGTTTTTTAGACAATTTTACTTCTGATATGTTGCAAAAACAATAATTGTTCAACATTTTATCCGCACTTCCATGTCTGGCCATTCTACATCTTAAAGCATATTTGATTCTTTGTAGTA
Associated Phenotype:
Not determined