Busch Lab

ZMP

agfg1b

Ensembl ID:
ENSDARG00000019526
ZFIN ID:
ZDB-GENE-040426-1520
Description:
ArfGAP with FG repeats 1b [Source:RefSeq peptide;Acc:NP_956882]
Human Orthologue:
AGFG1
Human Description:
ArfGAP with FG repeats 1 [Source:HGNC Symbol;Acc:5175]
Mouse Orthologue:
Agfg1
Mouse Description:
ArfGAP with FG repeats 1 Gene [Source:MGI Symbol;Acc:MGI:1333754]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa13458 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021158 Essential Splice Site 37 446 1 12
ENSDART00000092682 Essential Splice Site 56 547 1 17
ENSDART00000145107 Essential Splice Site 56 465 1 12
ENSDART00000146855 None None 262 None 7
Genomic Location (Zv9):
Chromosome 2 (position 16281218)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16792045
GRCz11 2 16460635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCAACATGACAGTGGGCTCGTTTGTGTGCACCACCTGTTCCGGAATACT[G/T]TAAGTTTATAACGAGGGCAGTCATATTCACACAGATGGTGTATGAACTTG
Associated Phenotype:
Not determined