Busch Lab

ZMP

sp7

Ensembl ID:
ENSDARG00000019516
ZFIN ID:
ZDB-GENE-040629-2
Description:
transcription factor Sp7 [Source:RefSeq peptide;Acc:NP_998028]
Human Orthologue:
SP7
Human Description:
Sp7 transcription factor [Source:HGNC Symbol;Acc:17321]
Mouse Orthologue:
Sp7
Mouse Description:
Sp7 transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:2153568]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40813 Nonsense Mutation detected in F1 DNA Not yet available
sa11475 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5393
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128793 Nonsense 164 440 2 3
Genomic Location (Zv9):
Chromosome 6 (position 58566183)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58669311
GRCz11 6 58663542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCATCCATCCAGGAATCACTGCGTCTCCTGCTAACGCCACGTCTTCTTG[G/A]TGGGATGTCCATACTAATGCCAACTGGCTAAGTCCAGGRCAGGCTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40813
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128793 Nonsense 281 440 3 3
Genomic Location (Zv9):
Chromosome 6 (position 58572278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58675406
GRCz11 6 58669637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATTGAGTCATTATCTCTCTGCAGGTCTTCTTGCGATTGCCCGAATTG[T/A]CAGGAGCTGGAAAGGCTCGGAGCGTCAGCAGCATCGCTGCGGAAGAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11475
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128793 Nonsense 293 440 3 3
Genomic Location (Zv9):
Chromosome 6 (position 58572313)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58675441
GRCz11 6 58669672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGATTGCCCGAATTGTCAGGAGCTGGAAAGGCTCGGAGCGTCAGCAGCAT[C/A]GCTGCGGAAGAAACCTGTCCACAGCKGCCACATCCCCGGCTGCGGGAAGG
Associated Phenotype:
Not determined