Busch Lab

ZMP

gtf2b

Ensembl ID:
ENSDARG00000019489
ZFIN ID:
ZDB-GENE-030131-3544
Description:
transcription initiation factor IIB [Source:RefSeq peptide;Acc:NP_955991]
Human Orthologue:
GTF2B
Human Description:
general transcription factor IIB [Source:HGNC Symbol;Acc:4648]
Mouse Orthologue:
Gtf2b
Mouse Description:
general transcription factor IIB Gene [Source:MGI Symbol;Acc:MGI:2385191]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3402
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023346 Essential Splice Site 179 316 5 7
ENSDART00000023346 Essential Splice Site 179 316 5 7
Genomic Location (Zv9):
Chromosome 2 (position 23060008)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22829906
GRCz11 2 22485557
KASP Assay ID:
2259-1943.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCTCTACATCGCATGCAGACAGGAGGGCGTCCCAAGAACATTTAAAGG[T/A]AAAACCTGCATACTCTTTCACTGACTAATCTGCACCATTGCATTAATGRT
Long Flanking Sequence:
AGGGACAACGTGAGAGATATTGTGCATGTAAAAGATTGAAGTTATTGATCACAATGAAGAGTTGTTTTTCAGAATGATTGGCTATAAAACAGATGCCCTCTATATTGTGACATGACAAACTAAACATGATAGTGTGTAAATTAAAACAAAATGGGCAAATCATTATTTTACATTCACTTTAGTCTGTCTCTATTTATTAATCTTTGATGATATTCCCTCTTTTATATGCTTTTTTCACAACATGGCCCTTATGATGATGGTGGCTAACTTTGAGGTTTCAAATTTGGGGTTTCCCAAAAGTAAAAAAGTCATCCCAAAAGTTTGCTCTGTTGAAAATCTGTTTGAATTGAATTGTGTTTTTTGTCACAGGATCGAACAAACAACTTGTTCAAACAGGTTTATGAACAGAAGAGTCTGAAAGGCAGAAGTAATGATGCTATTGCTTCAGCCTGCCTCTACATCGCATGCAGACAGGAGGGCGTCCCAAGAACATTTAAAGG[T/A]AAAACCTGCATACTCTTTCACTGACTAATCTGCACCATTGCATTAATGATTCTAATGTGTTTTTATCATTAAAGGTGAAGAATGTCTTTTTTTTGCGTTAAGATGCTGGTTTCTATTTTGTATAATTTCTAAGTTAATTGTGGGGTGCAAAGCCACAAACATTGTGTCTCCATCTGGCTATCAAAGCATTGCTTTGTTTAAGCATCATAAGTAAAAATCCCGTAAATTTTTTCCATAGATAAATAAATTTTTAAAATGCTAATGACTTAAATATGCTTTTATTGAACACATCTGTTCATGTTAATTCAGTCATAATCATAATAATCATAAGCTTATAATCATGTTTAAAATTAAATAAGCGAAAAAAGAAGGGTACTTTAATGAGTTAATGTATGTATATCCATTTATTTTTTAGGTCACAAACTTGAAACTAATAATAGAACAAAGGACCAAGGCTGCTAAAATGTGCACTTTAATAGAATGAGTTTATTTGTTTGTGT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
ventral mandibular arch
ZFA:0001273
decreased size
PATO:0000587
abnormal
PATO:0000460

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18726
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023346 Essential Splice Site 179 316 5 7
ENSDART00000023346 Essential Splice Site 179 316 5 7
Genomic Location (Zv9):
Chromosome 2 (position 23060008)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22829906
GRCz11 2 22485557
KASP Assay ID:
2259-1943.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTCTACATCGCATGCAGACAGGAGGGCGTCCCAAGAACATTTAAAGG[T/A]AAAACCTGCATACTCTTTCACTGACTAATCTGCACCATTGCATTAATGAT
Long Flanking Sequence:
AGGGACAACGTGAGAGATATTGTGCATGTAAAAGATTGAAGTTATTGATCACAATGAAGAGTTGTTTTTCAGAATGATTGGCTATAAAACAGATGCCCTCTATATTGTGACATGACAAACTAAACATGATAGTGTGTAAATTAAAACAAAATGGGCAAATCATTATTTTACATTCACTTTAGTCTGTCTCTATTTATTAATCTTTGATGATATTCCCTCTTTTATATGCTTTTTTCACAACATGGCCCTTATGATGATGGTGGCTAACTTTGAGGTTTCAAATTTGGGGTTTCCCAAAAGTAAAAAAGTCATCCCAAAAGTTTGCTCTGTTGAAAATCTGTTTGAATTGAATTGTGTTTTTTGTCACAGGATCGAACAAACAACTTGTTCAAACAGGTTTATGAACAGAAGAGTCTGAAAGGCAGAAGTAATGATGCTATTGCTTCAGCCTGCCTCTACATCGCATGCAGACAGGAGGGCGTCCCAAGAACATTTAAAGG[T/A]AAAACCTGCATACTCTTTCACTGACTAATCTGCACCATTGCATTAATGATTCTAATGTGTTTTTATCATTAAAGGTGAAGAATGTCTTTTTTTTGCGTTAAGATGCTGGTTTCTATTTTGTATAATTTCTAAGTTAATTGTGGGGTGCAAAGCCACAAACATTGTGTCTCCATCTGGCTATCAAAGCATTGCTTTGTTTAAGCATCATAAGTAAAAATCCCGTAAATTTTTTCCATAGATAAATAAATTTTTAAAATGCTAATGACTTAAATATGCTTTTATTGAACACATCTGTTCATGTTAATTCAGTCATAATCATAATAATCATAAGCTTATAATCATGTTTAAAATTAAATAAGCGAAAAAAGAAGGGTACTTTAATGAGTTAATGTATGTATATCCATTTATTTTTTAGGTCACAAACTTGAAACTAATAATAGAACAAAGGACCAAGGCTGCTAAAATGTGCACTTTAATAGAATGAGTTTATTTGTTTGTGT
Associated Phenotype:
Not determined